Quick Order

Human ATIC Gene ORF cDNA clone expression plasmid

  • Human ATIC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human ATIC cDNA Clone Product Information
NCBI RefSeq:NM_004044.5
RefSeq ORF Size:1779bp
cDNA Description:Full length Clone DNA of Homo sapiens 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase.
Gene Synonym:PURH, AICAR, AICARFT, FLJ93545, IMPCHASE, ATIC
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ATIC
Restriction Site:KpnI + XbaI (6.1kb + 1.78kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ATIC qPCR primers for gene expression analysis, HP101172 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ATIC Gene Plasmid Map
Human ATIC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11295-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"