Apg3/ATG3 cDNA ORF Clone, Human, untagged

Cat: HG15302-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Apg3/ATG3 Reagents
CRO Services
Product recommended

All Apg3/ATG3 Reagents
Apg3/ATG3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Human autophagy related 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Apg3/ATG3 cDNA ORF Clone, Human, untagged Alternative Names
APG3 cDNA ORF Clone, Human;APG3-LIKE cDNA ORF Clone, Human;APG3L cDNA ORF Clone, Human;PC3-96 cDNA ORF Clone, Human
Apg3/ATG3 Background Information
Full Name
autophagy related 3

Apg3/ATG3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Apg3/ATG3 cDNA ORF Clone in Cloning Vector, Rat RG84922-U
Apg3/ATG3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84922-ACGLN

Apg3/ATG3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Apg3/ATG3 cDNA ORF Clone in Cloning Vector, Mouse MG53262-U
Apg3/ATG3 cDNA ORF Clone, Mouse, untagged MG53262-UT
Apg3/ATG3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53262-ACG
Apg3/ATG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53262-ACGLN
Apg3/ATG3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53262-ANG
Apg3/ATG3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53262-ACR
Apg3/ATG3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53262-ANR
Apg3/ATG3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53262-CF
Apg3/ATG3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53262-NF
Apg3/ATG3 cDNA ORF Clone, Mouse, C-His tag MG53262-CH
Apg3/ATG3 cDNA ORF Clone, Mouse, N-His tag MG53262-NH
Apg3/ATG3 cDNA ORF Clone, Mouse, C-HA tag MG53262-CY
Apg3/ATG3 cDNA ORF Clone, Mouse, N-HA tag MG53262-NY
Apg3/ATG3 cDNA ORF Clone, Mouse, C-Myc tag MG53262-CM
Apg3/ATG3 cDNA ORF Clone, Mouse, N-Myc tag MG53262-NM

Apg3/ATG3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Apg3/ATG3 cDNA ORF Clone in Cloning Vector, Human HG15302-G
Apg3/ATG3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15302-ACG
Apg3/ATG3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15302-ACGLN
Apg3/ATG3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15302-ANG
Apg3/ATG3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15302-ACR
Apg3/ATG3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15302-ANR
Apg3/ATG3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15302-CF
Apg3/ATG3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15302-NF
Apg3/ATG3 cDNA ORF Clone, Human, C-His tag HG15302-CH
Apg3/ATG3 cDNA ORF Clone, Human, N-His tag HG15302-NH
Apg3/ATG3 cDNA ORF Clone, Human, C-HA tag HG15302-CY
Apg3/ATG3 cDNA ORF Clone, Human, N-HA tag HG15302-NY
Apg3/ATG3 cDNA ORF Clone, Human, C-Myc tag HG15302-CM
Apg3/ATG3 cDNA ORF Clone, Human, N-Myc tag HG15302-NM
Apg3/ATG3 qPCR Primer Pairs, Human HP103928
info info
添加购物车成功! 添加购物车失败!