ATG13/KIAA0652 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14124-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATG13/KIAA0652 Reagents
CRO Services
Product recommended

All ATG13/KIAA0652 Reagents
ATG13/KIAA0652 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1443 bp
Description
Full length Clone DNA of Human autophagy related 13 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG13/KIAA0652 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
KIAA0652 cDNA ORF Clone, Human;PARATARG8 cDNA ORF Clone, Human
ATG13/KIAA0652 Background Information
Full Name
autophagy related 13

ATG13/KIAA0652 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATG13/KIAA0652 cDNA ORF Clone in Cloning Vector, Mouse MG53171-G
ATG13/KIAA0652 cDNA ORF Clone, Mouse, untagged MG53171-UT
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53171-ACG
ATG13/KIAA0652 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53171-ACGLN
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53171-ANG
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53171-ACR
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53171-ANR
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53171-CF
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53171-NF
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-His tag MG53171-CH
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-His tag MG53171-NH
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-HA tag MG53171-CY
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-HA tag MG53171-NY
ATG13/KIAA0652 cDNA ORF Clone, Mouse, C-Myc tag MG53171-CM
ATG13/KIAA0652 cDNA ORF Clone, Mouse, N-Myc tag MG53171-NM

ATG13/KIAA0652 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATG13/KIAA0652 cDNA ORF Clone in Cloning Vector, Human HG14124-G
ATG13/KIAA0652 cDNA ORF Clone, Human, untagged HG14124-UT
ATG13/KIAA0652 cDNA ORF Clone, Human, C-GFPSpark® tag HG14124-ACG
ATG13/KIAA0652 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14124-ACGLN
ATG13/KIAA0652 cDNA ORF Clone, Human, N-GFPSpark® tag HG14124-ANG
ATG13/KIAA0652 cDNA ORF Clone, Human, C-OFPSpark® tag HG14124-ACR
ATG13/KIAA0652 cDNA ORF Clone, Human, N-OFPSpark® tag HG14124-ANR
ATG13/KIAA0652 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14124-CF
ATG13/KIAA0652 cDNA ORF Clone, Human, C-His tag HG14124-CH
ATG13/KIAA0652 cDNA ORF Clone, Human, N-His tag HG14124-NH
ATG13/KIAA0652 cDNA ORF Clone, Human, C-HA tag HG14124-CY
ATG13/KIAA0652 cDNA ORF Clone, Human, N-HA tag HG14124-NY
ATG13/KIAA0652 cDNA ORF Clone, Human, C-Myc tag HG14124-CM
ATG13/KIAA0652 cDNA ORF Clone, Human, N-Myc tag HG14124-NM
ATG13/KIAA0652 qPCR Primer Pairs, Human HP102777
info info
添加购物车成功! 添加购物车失败!