ATG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11111-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATG12 Reagents
CRO Services
Product recommended

All ATG12 Reagents
ATG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
603 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ATG12 autophagy related 12 homolog (S. cerevisiae) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.6kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ATG12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
ATG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
APG12 cDNA ORF Clone, Human;APG12L cDNA ORF Clone, Human;FBR93 cDNA ORF Clone, Human;HAPG12 cDNA ORF Clone, Human
ATG12 Background Information
Full Name
autophagy related 12

ATG12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATG12 cDNA ORF Clone in Cloning Vector, Mouse MG5A0758-U
ATG12 cDNA ORF Clone, Mouse, untagged MG5A0758-UT
ATG12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0758-ACG
ATG12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0758-ACGLN
ATG12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0758-ANG
ATG12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0758-ACR
ATG12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0758-ANR
ATG12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0758-CF
ATG12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0758-NF
ATG12 cDNA ORF Clone, Mouse, C-His tag MG5A0758-CH
ATG12 cDNA ORF Clone, Mouse, N-His tag MG5A0758-NH
ATG12 cDNA ORF Clone, Mouse, C-HA tag MG5A0758-CY
ATG12 cDNA ORF Clone, Mouse, N-HA tag MG5A0758-NY
ATG12 cDNA ORF Clone, Mouse, C-Myc tag MG5A0758-CM
ATG12 cDNA ORF Clone, Mouse, N-Myc tag MG5A0758-NM

ATG12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATG12 cDNA ORF Clone in Cloning Vector, Human HG11111-M
ATG12 cDNA ORF Clone, Human, untagged HG11111-UT
ATG12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11111-ACGLN
ATG12 cDNA ORF Clone, Human, C-GFPSpark® tag HG11111-ACG
ATG12 cDNA ORF Clone, Human, N-GFPSpark® tag HG11111-ANG
ATG12 cDNA ORF Clone, Human, C-OFPSpark® tag HG11111-ACR
ATG12 cDNA ORF Clone, Human, N-OFPSpark® tag HG11111-ANR
ATG12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11111-NF
ATG12 cDNA ORF Clone, Human, C-His tag HG11111-CH
ATG12 cDNA ORF Clone, Human, N-His tag HG11111-NH
ATG12 cDNA ORF Clone, Human, C-HA tag HG11111-CY
ATG12 cDNA ORF Clone, Human, N-HA tag HG11111-NY
ATG12 cDNA ORF Clone, Human, C-Myc tag HG11111-CM
ATG12 cDNA ORF Clone, Human, N-Myc tag HG11111-NM
ATG12 qPCR Primer Pairs, Human HP101026
info info
添加购物车成功! 添加购物车失败!