Text Size:AAA

Human ATF2 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ATF2 cDNA Clone Product Information
    NCBI RefSeq:NM_001880.2
    RefSeq ORF Size:1518bp
    cDNA Description:Full length Clone DNA of Homo sapiens activating transcription factor 2 with C terminal His tag.
    Gene Synonym:HB16, CREB2, TREB7, CRE-BP1, MGC111558, ATF2
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATF2 qPCR primers for gene expression analysis, HP101660 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 

    References
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • Size / Price
    Catalog: HG11599-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"