ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-His tag

Cat: HG16454-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ASNS/Asparagine synthetase Reagents
CRO Services
Product recommended

All ASNS/Asparagine synthetase Reagents
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1686 bp
Description
Full length Clone DNA of Human asparagine synthetase (glutamine-hydrolyzing) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-His tag Alternative Names
ASNSD cDNA ORF Clone, Human;TS11 cDNA ORF Clone, Human
ASNS/Asparagine synthetase Background Information
Full Name
asparagine synthetase (glutamine-hydrolyzing)

ASNS/Asparagine synthetase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ASNS/Asparagine synthetase cDNA ORF Clone in Cloning Vector, Rat RG82652-U
ASNS/Asparagine synthetase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82652-ACGLN

ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ASNS/Asparagine synthetase cDNA ORF Clone in Cloning Vector, Mouse MG52349-G
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, untagged MG52349-UT
ASNS/Asparagine synthetase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52349-ACGLN
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52349-ACG
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52349-ANG
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52349-ACR
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52349-ANR
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52349-CF
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52349-NF
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-His tag MG52349-CH
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-His tag MG52349-NH
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-HA tag MG52349-CY
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-HA tag MG52349-NY
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, C-Myc tag MG52349-CM
ASNS/Asparagine synthetase cDNA ORF Clone, Mouse, N-Myc tag MG52349-NM
ASNS/Asparagine synthetase qPCR Primer Pairs, Mouse MP202222

ASNS/Asparagine synthetase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ASNS/Asparagine synthetase cDNA ORF Clone in Cloning Vector, Human HG16454-G
ASNS/Asparagine synthetase cDNA ORF Clone, Human, untagged HG16454-UT
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-GFPSpark® tag HG16454-ACG
ASNS/Asparagine synthetase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16454-ACGLN
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-GFPSpark® tag HG16454-ANG
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-OFPSpark® tag HG16454-ACR
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-OFPSpark® tag HG16454-ANR
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16454-CF
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16454-NF
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-His tag HG16454-NH
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-HA tag HG16454-CY
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-HA tag HG16454-NY
ASNS/Asparagine synthetase cDNA ORF Clone, Human, C-Myc tag HG16454-CM
ASNS/Asparagine synthetase cDNA ORF Clone, Human, N-Myc tag HG16454-NM
ASNS/Asparagine synthetase qPCR Primer Pairs, Human HP105200
info info
添加购物车成功! 添加购物车失败!