Quick Order

Human ASGR2 / ASGPR2 transcript variant 4 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ASGR2 cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:921bp
    cDNA Description:Full length Clone DNA of Homo sapiens asialoglycoprotein receptor 2, transcript variant 4 with C terminal His tag.
    Gene Synonym:HL-2, HBXBP, ASGPR2, ASGP-R2, CLEC4H2, ASGR2
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ASGR2 qPCR primers for gene expression analysis, HP102210 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    ASGR2 is a subunit of the asialoglycoprotein receptor. Asialoglycoprotein receptor, also known as the Ashwell receptor, which is specific for desialylated (galactosyl-terminal) glycoproteins and is expressed exclusively in hepatic parenchymal cells. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. ASGR2 is a glycoprotein. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. ASGR2 is the less abundant minor subunit.

    References
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2011) Asialoglycoprotein receptor interacts with the preS1 domain of hepatitis B virus in vivo and in vitro. Arch Virol. 156(4):637-45.
  • Guy CS, et al. (2011) Hepatocyte cytotoxicity is facilitated by asialoglycoprotein receptor. Hepatology. 54(3):1043-50.
  • Size / Price
    Catalog: HG13524-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"