ASGR2 cDNA ORF Clone, Human, C-His tag

Cat: HG13523-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ASGR2 Reagents
CRO Services
Product recommended

All ASGR2 Reagents
ASGR2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
864 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human asialoglycoprotein receptor 2, transcript variant 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI (6kb + 0.91kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ASGR2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ASGR2 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
ASGR2 cDNA ORF Clone, Human, C-His tag Alternative Names
ASGP-R2 cDNA ORF Clone, Human;ASGPR2 cDNA ORF Clone, Human;CLEC4H2 cDNA ORF Clone, Human;HBXBP cDNA ORF Clone, Human;HL-2 cDNA ORF Clone, Human
ASGR2 Background Information

ASGR2 is a subunit of the asialoglycoprotein receptor. Asialoglycoprotein receptor, also known as the Ashwell receptor, which is specific for desialylated (galactosyl-terminal) glycoproteins and is expressed exclusively in hepatic parenchymal cells. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. ASGR2 is a glycoprotein. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. ASGR2 is the less abundant minor subunit.

Full Name
asialoglycoprotein receptor 2
References
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2011) Asialoglycoprotein receptor interacts with the preS1 domain of hepatitis B virus in vivo and in vitro. Arch Virol. 156(4):637-45.
  • Guy CS, et al. (2011) Hepatocyte cytotoxicity is facilitated by asialoglycoprotein receptor. Hepatology. 54(3):1043-50.
  • info info
    添加购物车成功! 添加购物车失败!