Quick Order

Human ASGR2 / ASGPR2 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tag

  • Human ASGR2 transcript variant 2 ORF mammalian expression plasmid, C-His tag
DatasheetReviewsRelated ProductsProtocols
Human ASGR2 cDNA Clone Product Information
NCBI RefSeq:NM_080913.3
RefSeq ORF Size:864bp
cDNA Description:Full length Clone DNA of Homo sapiens asialoglycoprotein receptor 2, transcript variant 2 with C terminal His tag.
Gene Synonym:HL-2, HBXBP, ASGPR2, ASGP-R2, CLEC4H2, ASGR2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-ASGR2-His
Restriction Site:KpnI + XbaI (6kb + 0.91kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ASGR2 qPCR primers for gene expression analysis, HP102210 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ASGR2 Gene Plasmid Map
Human ASGR2 transcript variant 2 ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ASGR2 is a subunit of the asialoglycoprotein receptor. Asialoglycoprotein receptor, also known as the Ashwell receptor, which is specific for desialylated (galactosyl-terminal) glycoproteins and is expressed exclusively in hepatic parenchymal cells. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. ASGR2 is a glycoprotein. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. ASGR2 is the less abundant minor subunit.

References
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Zhang X, et al. (2011) Asialoglycoprotein receptor interacts with the preS1 domain of hepatitis B virus in vivo and in vitro. Arch Virol. 156(4):637-45.
  • Guy CS, et al. (2011) Hepatocyte cytotoxicity is facilitated by asialoglycoprotein receptor. Hepatology. 54(3):1043-50.
  • Size / Price
    Catalog: HG13523-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"