Quick Order

Text Size:AAA

Human ASGPR1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ASGR1 cDNA Clone Product Information
NCBI RefSeq:NM_001671.3
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Homo sapiens asialoglycoprotein receptor 1.
Gene Synonym:ASGPR, CLEC4H1, Hs.12056
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ASGR1
Restriction Site:HindIII + XbaI (6.1kb + 0.88kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ASGR1 Gene Plasmid Map
Human ASGPR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

The asialoglycoprotein receptor (ASGPR), an endocytotic cell surface receptor expressed by hepatocytes, is triggered by triantennary binding to galactose residues of macromolecules such as asialoorosomucoid (ASOR). ASGPR belongs to the long-form subfamily of the C-type/Ca2+ dependent lectin family. It is a complex of two noncovalently-linked and highly homologous subunits, a major 42 kDa glycoprotein ASGPR1(MHL-1) and a minor 51 kDa glycoprotein ASGR2 (MHL-2). ASGPR1 is synthesized as a type II transmembrane protein that contains a cytosolic N-terminal domain, a single transmembrane segment, and an extracellular domain which contains two important structural regions. The first is a stalk domain that contributes to noncovalent oligomerization, and the second is a Ca2+-dependent carbohydrate binding domain at the very C-terminus that is unusually stabilized by three ions. The research regarded that ASGPR1 could be targeted for anti- hepatitis B virus (HBV) drug development.

References
  • Yang J, et al. (2006) Antisense oligonucleotides targeted against asialoglycoprotein receptor 1 block human hepatitis B virus replication. J Viral Hepat. 13(3): 158-65.
  • Li Y, et al. (2008) Targeted delivery of macromolecular drugs: asialoglycoprotein receptor (ASGPR) expression by selected hepatoma cell lines used in antiviral drug development. Curr Drug Deliv. 5(4): 299-302.
  • Size / Price
    Catalog: HG10773-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"