Quick Order

Text Size:AAA

Human ART3 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human ART3 cDNA Clone Product Information
NCBI RefSeq:BC008397
RefSeq ORF Size:1170bp
cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosyltransferase 3 with C terminal His tag.
Gene Synonym:ART3
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. It is expressed specifically in testis. ART3 pseudogene is located on chromosome 11. ART3 was identified as a susceptibility gene for non-obstructive azoospermia (NOA). It is a novel therapeutic target in the treatment of NOA.

References
  • Lévy I, et al. (1996) Human testis specifically expresses a homologue of the rodent T lymphocytes RT6 mRNA. FEBS Lett. 382(3):276-80.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2):149-56.
  • Balducci E, et al. (1999) Selective expression of RT6 superfamily in human bronchial epithelial cells. Am J Respir. 21(3):337-46.
  • Size / Price
    Catalog: HG13542-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"