Quick Order

Text Size:AAA

Human ART3 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human ART3 cDNA Clone Product Information
    NCBI RefSeq:BC008397
    RefSeq ORF Size:1170bp
    cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosyltransferase 3 with C terminal HA tag.
    Gene Synonym:ART3
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ART3 qPCR primers for gene expression analysis, HP102228 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    ART3 is an arginine-specific ADP-ribosyltransferase which belongs to the Arg-specific ADP-ribosyltransferase family. ART3 catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. It is expressed specifically in testis. ART3 pseudogene is located on chromosome 11. ART3 was identified as a susceptibility gene for non-obstructive azoospermia (NOA). It is a novel therapeutic target in the treatment of NOA.

    References
  • Lévy I, et al. (1996) Human testis specifically expresses a homologue of the rodent T lymphocytes RT6 mRNA. FEBS Lett. 382(3):276-80.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200 (1-2):149-56.
  • Balducci E, et al. (1999) Selective expression of RT6 superfamily in human bronchial epithelial cells. Am J Respir. 21(3):337-46.
  • Size / Price
    Catalog: HG13542-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"