ARSB cDNA ORF Clone, Human, C-Myc tag

Cat: HG13674-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARSB Reagents
CRO Services
Product recommended

All ARSB Reagents
ARSB cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1602 bp
Description
Full length Clone DNA of Human arylsulfatase B with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARSB cDNA ORF Clone, Human, C-Myc tag Alternative Names
ASB cDNA ORF Clone, Human;G4S cDNA ORF Clone, Human;MPS6 cDNA ORF Clone, Human
ARSB Background Information
Full Name
arylsulfatase B

ARSB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARSB cDNA ORF Clone in Cloning Vector, Mouse MG53483-G
ARSB cDNA ORF Clone, Mouse, untagged MG53483-UT
ARSB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53483-ACG
ARSB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53483-ACGLN
ARSB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53483-ACR
ARSB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53483-CF
ARSB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53483-NF
ARSB cDNA ORF Clone, Mouse, C-His tag MG53483-CH
ARSB cDNA ORF Clone, Mouse, N-His tag MG53483-NH
ARSB cDNA ORF Clone, Mouse, C-HA tag MG53483-CY
ARSB cDNA ORF Clone, Mouse, N-HA tag MG53483-NY
ARSB cDNA ORF Clone, Mouse, C-Myc tag MG53483-CM
ARSB cDNA ORF Clone, Mouse, N-Myc tag MG53483-NM

ARSB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARSB cDNA ORF Clone in Cloning Vector, Human HG13674-G
ARSB cDNA ORF Clone, Human, untagged HG13674-UT
ARSB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13674-ACGLN
ARSB cDNA ORF Clone, Human, C-GFPSpark® tag HG13674-ACG
ARSB cDNA ORF Clone, Human, C-OFPSpark® tag HG13674-ACR
ARSB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13674-CF
ARSB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13674-NF
ARSB cDNA ORF Clone, Human, C-His tag HG13674-CH
ARSB cDNA ORF Clone, Human, N-His tag HG13674-NH
ARSB cDNA ORF Clone, Human, C-HA tag HG13674-CY
ARSB cDNA ORF Clone, Human, N-HA tag HG13674-NY
ARSB cDNA ORF Clone, Human, N-Myc tag HG13674-NM
ARSB qPCR Primer Pairs, Human HP102353
info info
添加购物车成功! 添加购物车失败!