Quick Order

Human Arylsulfatase A / ARSA Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ARSA cDNA Clone Product Information
    NCBI RefSeq:NM_000487.4
    RefSeq ORF Size:1524bp
    cDNA Description:Full length Clone DNA of Homo sapiens arylsulfatase A with C terminal His tag.
    Gene Synonym:MLD, ARSA
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ARSA qPCR primers for gene expression analysis, HP100478 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

    References
  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    Catalog: HG10449-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"