ARPC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11037-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARPC4 Reagents
CRO Services
Product recommended

All ARPC4 Reagents
ARPC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Human actin related protein 2/3 complex, subunit 4, 20kDa with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ARC20 cDNA ORF Clone, Human;P20-ARC cDNA ORF Clone, Human
ARPC4 Background Information
Full Name
actin related protein 2/3 complex, subunit 4, 20kDa

ARPC4 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ARPC4 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90399-G
ARPC4 cDNA ORF Clone, Cynomolgus, untagged CG90399-UT
ARPC4 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90399-ACGLN
ARPC4 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90399-ACG
ARPC4 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90399-ANG
ARPC4 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90399-ACR
ARPC4 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90399-ANR
ARPC4 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90399-CF
ARPC4 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90399-NF
ARPC4 cDNA ORF Clone, Cynomolgus, C-His tag CG90399-CH
ARPC4 cDNA ORF Clone, Cynomolgus, N-His tag CG90399-NH
ARPC4 cDNA ORF Clone, Cynomolgus, C-HA tag CG90399-CY
ARPC4 cDNA ORF Clone, Cynomolgus, N-HA tag CG90399-NY
ARPC4 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90399-CM
ARPC4 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90399-NM

ARPC4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARPC4 cDNA ORF Clone in Cloning Vector, Rat RG81395-G

ARPC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARPC4 cDNA ORF Clone in Cloning Vector, Mouse MG51362-U
ARPC4 cDNA ORF Clone, Mouse, untagged MG51362-UT
ARPC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51362-ACGLN
ARPC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51362-ACG
ARPC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51362-ANG
ARPC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51362-ACR
ARPC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51362-ANR
ARPC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51362-CF
ARPC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51362-NF
ARPC4 cDNA ORF Clone, Mouse, C-His tag MG51362-CH
ARPC4 cDNA ORF Clone, Mouse, N-His tag MG51362-NH
ARPC4 cDNA ORF Clone, Mouse, C-HA tag MG51362-CY
ARPC4 cDNA ORF Clone, Mouse, N-HA tag MG51362-NY
ARPC4 cDNA ORF Clone, Mouse, C-Myc tag MG51362-CM
ARPC4 cDNA ORF Clone, Mouse, N-Myc tag MG51362-NM
ARPC4 qPCR Primer Pairs, Mouse MP201238

ARPC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPC4 cDNA ORF Clone in Cloning Vector, Human HG11037-M
ARPC4 cDNA ORF Clone, Human, untagged HG11037-UT
ARPC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11037-ACG
ARPC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11037-ACGLN
ARPC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG11037-ANG
ARPC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11037-ACR
ARPC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG11037-ANR
ARPC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11037-NF
ARPC4 cDNA ORF Clone, Human, C-His tag HG11037-CH
ARPC4 cDNA ORF Clone, Human, N-His tag HG11037-NH
ARPC4 cDNA ORF Clone, Human, C-HA tag HG11037-CY
ARPC4 cDNA ORF Clone, Human, N-HA tag HG11037-NY
ARPC4 cDNA ORF Clone, Human, C-Myc tag HG11037-CM
ARPC4 cDNA ORF Clone, Human, N-Myc tag HG11037-NM
ARPC4 qPCR Primer Pairs, Human HP100994
info info
添加购物车成功! 添加购物车失败!