ARPC3/p21-ARC cDNA ORF Clone, Human, untagged

Cat: HG15349-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARPC3/p21-ARC Reagents
CRO Services
Product recommended

All ARPC3/p21-ARC Reagents
ARPC3/p21-ARC cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
537 bp
Description
Full length Clone DNA of Human actin related protein 2/3 complex, subunit 3, 21kDa.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPC3/p21-ARC cDNA ORF Clone, Human, untagged Alternative Names
ARC21 cDNA ORF Clone, Human;p21-Arc cDNA ORF Clone, Human
ARPC3/p21-ARC Background Information
Full Name
actin related protein 2/3 complex, subunit 3, 21kDa

ARPC3/p21-ARC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARPC3/p21-ARC cDNA ORF Clone in Cloning Vector, Mouse MG52832-G
ARPC3/p21-ARC cDNA ORF Clone, Mouse, untagged MG52832-UT
ARPC3/p21-ARC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52832-ACGLN
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52832-ACG
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52832-ACR
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52832-CF
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52832-NF
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-His tag MG52832-CH
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-His tag MG52832-NH
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-HA tag MG52832-CY
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-HA tag MG52832-NY
ARPC3/p21-ARC cDNA ORF Clone, Mouse, C-Myc tag MG52832-CM
ARPC3/p21-ARC cDNA ORF Clone, Mouse, N-Myc tag MG52832-NM

ARPC3/p21-ARC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPC3/p21-ARC cDNA ORF Clone in Cloning Vector, Human HG15349-G
ARPC3/p21-ARC cDNA ORF Clone, Human, C-GFPSpark® tag HG15349-ACG
ARPC3/p21-ARC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15349-ACGLN
ARPC3/p21-ARC cDNA ORF Clone, Human, N-GFPSpark® tag HG15349-ANG
ARPC3/p21-ARC cDNA ORF Clone, Human, C-OFPSpark® tag HG15349-ACR
ARPC3/p21-ARC cDNA ORF Clone, Human, N-OFPSpark® tag HG15349-ANR
ARPC3/p21-ARC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15349-CF
ARPC3/p21-ARC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15349-NF
ARPC3/p21-ARC cDNA ORF Clone, Human, C-His tag HG15349-CH
ARPC3/p21-ARC cDNA ORF Clone, Human, N-His tag HG15349-NH
ARPC3/p21-ARC cDNA ORF Clone, Human, C-HA tag HG15349-CY
ARPC3/p21-ARC cDNA ORF Clone, Human, N-HA tag HG15349-NY
ARPC3/p21-ARC cDNA ORF Clone, Human, C-Myc tag HG15349-CM
ARPC3/p21-ARC cDNA ORF Clone, Human, N-Myc tag HG15349-NM
ARPC3/p21-ARC qPCR Primer Pairs, Human HP103973
info info
添加购物车成功! 添加购物车失败!