ARL6IP1/ARMER cDNA ORF Clone, Human, N-His tag

Cat: HG14992-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARL6IP1/ARMER Reagents
CRO Services
Product recommended

All ARL6IP1/ARMER Reagents
ARL6IP1/ARMER cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
612 bp
Description
Full length Clone DNA of Human ADP-ribosylation factor-like 6 interacting protein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARL6IP1/ARMER cDNA ORF Clone, Human, N-His tag Alternative Names
AIP1 cDNA ORF Clone, Human;ARL6IP cDNA ORF Clone, Human;ARMER cDNA ORF Clone, Human;SPG61 cDNA ORF Clone, Human
ARL6IP1/ARMER Background Information
Full Name
ADP-ribosylation factor-like 6 interacting protein 1

ARL6IP1/ARMER cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARL6IP1/ARMER cDNA ORF Clone in Cloning Vector, Mouse MG5A2267-U
ARL6IP1/ARMER cDNA ORF Clone, Mouse, untagged MG5A2267-UT
ARL6IP1/ARMER Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2267-ACGLN
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2267-ACG
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2267-ACR
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2267-CF
ARL6IP1/ARMER cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2267-NF
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-His tag MG5A2267-CH
ARL6IP1/ARMER cDNA ORF Clone, Mouse, N-His tag MG5A2267-NH
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-HA tag MG5A2267-CY
ARL6IP1/ARMER cDNA ORF Clone, Mouse, N-HA tag MG5A2267-NY
ARL6IP1/ARMER cDNA ORF Clone, Mouse, C-Myc tag MG5A2267-CM
ARL6IP1/ARMER cDNA ORF Clone, Mouse, N-Myc tag MG5A2267-NM

ARL6IP1/ARMER cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARL6IP1/ARMER cDNA ORF Clone in Cloning Vector, Human HG14992-G
ARL6IP1/ARMER cDNA ORF Clone, Human, untagged HG14992-UT
ARL6IP1/ARMER Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14992-ACGLN
ARL6IP1/ARMER cDNA ORF Clone, Human, C-GFPSpark® tag HG14992-ACG
ARL6IP1/ARMER cDNA ORF Clone, Human, C-OFPSpark® tag HG14992-ACR
ARL6IP1/ARMER cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14992-CF
ARL6IP1/ARMER cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14992-NF
ARL6IP1/ARMER cDNA ORF Clone, Human, C-His tag HG14992-CH
ARL6IP1/ARMER cDNA ORF Clone, Human, C-HA tag HG14992-CY
ARL6IP1/ARMER cDNA ORF Clone, Human, N-HA tag HG14992-NY
ARL6IP1/ARMER cDNA ORF Clone, Human, C-Myc tag HG14992-CM
ARL6IP1/ARMER cDNA ORF Clone, Human, N-Myc tag HG14992-NM
ARL6IP1/ARMER qPCR Primer Pairs, Human HP103620
info info
添加购物车成功! 添加购物车失败!