ARF4L/ARL4D cDNA ORF Clone, Human, N-Myc tag

Cat: HG14381-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARF4L/ARL4D Reagents
CRO Services
Product recommended

All ARF4L/ARL4D Reagents
ARF4L/ARL4D cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Human ADP-ribosylation factor-like 4D with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF4L/ARL4D cDNA ORF Clone, Human, N-Myc tag Alternative Names
ARF4L cDNA ORF Clone, Human;ARL6 cDNA ORF Clone, Human
ARF4L/ARL4D Background Information
Full Name
ADP-ribosylation factor-like 4D

ARF4L/ARL4D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARF4L/ARL4D cDNA ORF Clone in Cloning Vector, Mouse MG52685-G
ARF4L/ARL4D cDNA ORF Clone, Mouse, untagged MG52685-UT
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52685-ACG
ARF4L/ARL4D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52685-ACGLN
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52685-ANG
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52685-ACR
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52685-ANR
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52685-CF
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52685-NF
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-His tag MG52685-CH
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-His tag MG52685-NH
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-HA tag MG52685-CY
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-HA tag MG52685-NY
ARF4L/ARL4D cDNA ORF Clone, Mouse, C-Myc tag MG52685-CM
ARF4L/ARL4D cDNA ORF Clone, Mouse, N-Myc tag MG52685-NM
ARF4L/ARL4D qPCR Primer Pairs, Mouse MP202556

ARF4L/ARL4D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARF4L/ARL4D cDNA ORF Clone in Cloning Vector, Human HG14381-G
ARF4L/ARL4D cDNA ORF Clone, Human, untagged HG14381-UT
ARF4L/ARL4D cDNA ORF Clone, Human, C-GFPSpark® tag HG14381-ACG
ARF4L/ARL4D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14381-ACGLN
ARF4L/ARL4D cDNA ORF Clone, Human, N-GFPSpark® tag HG14381-ANG
ARF4L/ARL4D cDNA ORF Clone, Human, C-OFPSpark® tag HG14381-ACR
ARF4L/ARL4D cDNA ORF Clone, Human, N-OFPSpark® tag HG14381-ANR
ARF4L/ARL4D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14381-CF
ARF4L/ARL4D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14381-NF
ARF4L/ARL4D cDNA ORF Clone, Human, C-His tag HG14381-CH
ARF4L/ARL4D cDNA ORF Clone, Human, N-His tag HG14381-NH
ARF4L/ARL4D cDNA ORF Clone, Human, C-HA tag HG14381-CY
ARF4L/ARL4D cDNA ORF Clone, Human, N-HA tag HG14381-NY
ARF4L/ARL4D cDNA ORF Clone, Human, C-Myc tag HG14381-CM
ARF4L/ARL4D qPCR Primer Pairs, Human HP103030
info info
添加购物车成功! 添加购物车失败!