Quick Order

Human ARL2BP / BART1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ARL2BP cDNA Clone Product Information
NCBI RefSeq:BC003087
RefSeq ORF Size:492bp
cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosylation factor-like 2 binding protein with N terminal His tag.
Gene Synonym:BART, BART1, ARL2BP
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. ARL2BP binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of ARL2BP or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. ARL2BP is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. ARL2BP, together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. ARL2BP may play a role as an effector of ARL2.

References
  • Qiu J. et al., 2011, PLoS Pathog. 7 (8): e1002193.
  • Taniuchi K. et al., 2012, PLoS One. 7 (4): e35674.
  • Taniuchi K. et al., 2012, Neoplasia. 14 (5): 440-50.
  • Size / Price
    Catalog: HG14357-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"