ARG2/Arginase II cDNA ORF Clone, Human, N-His tag

Cat: HG14403-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARG2/Arginase II Reagents
CRO Services
Product recommended

All ARG2/Arginase II Reagents
ARG2/Arginase II cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human arginase, type II with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARG2/Arginase II Background Information
Full Name
arginase 2

ARG2/Arginase II cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARG2/Arginase II cDNA ORF Clone in Cloning Vector, Mouse MG53352-U
ARG2/Arginase II cDNA ORF Clone, Mouse, untagged MG53352-UT
ARG2/Arginase II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53352-ACGLN
ARG2/Arginase II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53352-ACG
ARG2/Arginase II cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53352-ANG
ARG2/Arginase II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53352-ACR
ARG2/Arginase II cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53352-ANR
ARG2/Arginase II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53352-CF
ARG2/Arginase II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53352-NF
ARG2/Arginase II cDNA ORF Clone, Mouse, C-His tag MG53352-CH
ARG2/Arginase II cDNA ORF Clone, Mouse, N-His tag MG53352-NH
ARG2/Arginase II cDNA ORF Clone, Mouse, C-HA tag MG53352-CY
ARG2/Arginase II cDNA ORF Clone, Mouse, N-HA tag MG53352-NY
ARG2/Arginase II cDNA ORF Clone, Mouse, C-Myc tag MG53352-CM
ARG2/Arginase II cDNA ORF Clone, Mouse, N-Myc tag MG53352-NM

ARG2/Arginase II cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARG2/Arginase II cDNA ORF Clone in Cloning Vector, Human HG14403-G
ARG2/Arginase II cDNA ORF Clone, Human, untagged HG14403-UT
ARG2/Arginase II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14403-ACGLN
ARG2/Arginase II cDNA ORF Clone, Human, C-GFPSpark® tag HG14403-ACG
ARG2/Arginase II cDNA ORF Clone, Human, N-GFPSpark® tag HG14403-ANG
ARG2/Arginase II cDNA ORF Clone, Human, C-OFPSpark® tag HG14403-ACR
ARG2/Arginase II cDNA ORF Clone, Human, N-OFPSpark® tag HG14403-ANR
ARG2/Arginase II cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14403-CF
ARG2/Arginase II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14403-NF
ARG2/Arginase II cDNA ORF Clone, Human, C-His tag HG14403-CH
ARG2/Arginase II cDNA ORF Clone, Human, C-HA tag HG14403-CY
ARG2/Arginase II cDNA ORF Clone, Human, N-HA tag HG14403-NY
ARG2/Arginase II cDNA ORF Clone, Human, C-Myc tag HG14403-CM
ARG2/Arginase II cDNA ORF Clone, Human, N-Myc tag HG14403-NM
ARG2/Arginase II qPCR Primer Pairs, Human HP103052
info info
添加购物车成功! 添加购物车失败!