Arginase cDNA ORF Clone, Human, N-Myc tag

Cat: HG11558-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Arginase Reagents
CRO Services
Product recommended

All Arginase Reagents
Arginase cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
969 bp
Description
Full length Clone DNA of Human arginase, liver with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arginase cDNA ORF Clone, Human, N-Myc tag Alternative Names
ARG1 cDNA ORF Clone, Human
Arginase Background Information

Arginase is the focal enzyme of the urea cycle hydrolysing L-arginine to urea and L-ornithine. Emerging studies have identified arginase in the vasculature and have implicated this enzyme in the regulation of nitric oxide (NO) synthesis and the development of vascular disease. Arginase also redirects the metabolism of L-arginine to L-ornithine and the formation of polyamines and L-proline, which are essential for smooth muscle cell growth and collagen synthesis. Arginase is encoded by two recently discovered genes (Arginase I and Arginase II). In most mammals, Arginase 1 (ARG1) also known as Arginase, liver, which functions in the urea cycle, and is located primarily in the cytoplasm of the liver. The second isozyme, Arginase II, has been implicated in the regulation of the arginine/ornithine concentrations in the cell. It is located in mitochondria of several tissues in the body, with most abundance in the kidney and prostate. It may be found at lower levels in macrophages, lactating mammary glands, and brain.

Full Name
arginase 1
References
  • Durante W, et al. (2007) Arginase: a critical regulator of nitric oxide synthesis and vascular function. Clin Exp Pharmacol Physiol. 34(9): 906-11.
  • Waddington SN. (2002) Arginase in glomerulonephritis. Kidney Int. 61(3): 876-81.
  • Morris SM. (2002). Regulation of enzymes of the urea cycle and arginine metabolism. Annual review of nutrition. 22 (1): 87-105.
  • Arginase cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Arginase cDNA ORF Clone in Cloning Vector, Rat RG81309-U
    Arginase cDNA ORF Clone, Rat, untagged RG81309-UT
    Arginase cDNA ORF Clone, Rat, C-GFPSpark® tag RG81309-ACG
    Arginase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81309-ACGLN
    Arginase cDNA ORF Clone, Rat, N-GFPSpark® tag RG81309-ANG
    Arginase cDNA ORF Clone, Rat, C-OFPSpark® tag RG81309-ACR
    Arginase cDNA ORF Clone, Rat, N-OFPSpark® tag RG81309-ANR
    Arginase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81309-CF
    Arginase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81309-NF
    Arginase cDNA ORF Clone, Rat, C-His tag RG81309-CH
    Arginase cDNA ORF Clone, Rat, N-His tag RG81309-NH
    Arginase cDNA ORF Clone, Rat, C-HA tag RG81309-CY
    Arginase cDNA ORF Clone, Rat, N-HA tag RG81309-NY
    Arginase cDNA ORF Clone, Rat, C-Myc tag RG81309-CM
    Arginase cDNA ORF Clone, Rat, N-Myc tag RG81309-NM
    Arginase qPCR Primer Pairs, Rat RP301265

    Arginase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Arginase cDNA ORF Clone in Cloning Vector, Mouse MG53754-U
    Arginase cDNA ORF Clone, Mouse, untagged MG53754-UT
    Arginase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53754-ACGLN
    Arginase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53754-ACG
    Arginase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53754-ACR
    Arginase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53754-CF
    Arginase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53754-NF
    Arginase cDNA ORF Clone, Mouse, C-His tag MG53754-CH
    Arginase cDNA ORF Clone, Mouse, N-His tag MG53754-NH
    Arginase cDNA ORF Clone, Mouse, C-HA tag MG53754-CY
    Arginase cDNA ORF Clone, Mouse, N-HA tag MG53754-NY
    Arginase cDNA ORF Clone, Mouse, C-Myc tag MG53754-CM
    Arginase cDNA ORF Clone, Mouse, N-Myc tag MG53754-NM

    Arginase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Arginase cDNA ORF Clone in Cloning Vector, Human HG11558-M
    Arginase cDNA ORF Clone, Human, untagged HG11558-UT
    Arginase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11558-ACGLN
    Arginase cDNA ORF Clone, Human, C-GFPSpark® tag HG11558-ACG
    Arginase cDNA ORF Clone, Human, N-GFPSpark® tag HG11558-ANG
    Arginase cDNA ORF Clone, Human, C-OFPSpark® tag HG11558-ACR
    Arginase cDNA ORF Clone, Human, N-OFPSpark® tag HG11558-ANR
    Arginase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11558-CF
    Arginase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11558-NF
    Arginase cDNA ORF Clone, Human, C-His tag HG11558-CH
    Arginase cDNA ORF Clone, Human, N-His tag HG11558-NH
    Arginase cDNA ORF Clone, Human, C-HA tag HG11558-CY
    Arginase cDNA ORF Clone, Human, N-HA tag HG11558-NY
    Arginase cDNA ORF Clone, Human, C-Myc tag HG11558-CM
    Arginase qPCR Primer Pairs, Human HP100084
    info info
    添加购物车成功! 添加购物车失败!