Text Size:AAA

Human ARF5 / ADP-ribosylation factor 5 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human ARF5 cDNA Clone Product Information
    NCBI RefSeq:BC003043
    RefSeq ORF Size:543bp
    cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosylation factor 5.
    Gene Synonym:ARF5
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ARF5 qPCR primers for gene expression analysis, HP103563 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Human ARF5 / ADP-ribosylation factor 5 Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    Background

    ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this family stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF5 functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. ARF5 Is involved in protein trafficking. ARF5 may also modulate vesicle budding and uncoating within the Golgi apparatus.

    References
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Tsuchiya M. et al., 1991, J Biol Chem. 266 (5): 2772-7.
  • McGuire RE. et al., 1997, Genomics. 41 (3): 481-4.
  • Size / Price
    Catalog: HG14934-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"