Quick Order

Human ARF5 / ADP-ribosylation factor 5 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human ARF5 cDNA Clone Product Information
NCBI RefSeq:BC003043
RefSeq ORF Size:543bp
cDNA Description:Full length Clone DNA of Homo sapiens ADP-ribosylation factor 5 with N terminal His tag.
Gene Synonym:ARF5
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human ARF5 / ADP-ribosylation factor 5 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Product nameProduct name
Background

ARF5, also known as ADP-ribosylation factor 5, belongs to the small GTPase superfamily, Arf family. Members of this family stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF5 functions as an allosteric activator of the cholera toxin catalytic subunit, an ADP-ribosyltransferase. ARF5 Is involved in protein trafficking. ARF5 may also modulate vesicle budding and uncoating within the Golgi apparatus.

References
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Tsuchiya M. et al., 1991, J Biol Chem. 266 (5): 2772-7.
  • McGuire RE. et al., 1997, Genomics. 41 (3): 481-4.
  • Size / Price
    Catalog: HG14934-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"