ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-HA tag

Cat: HG14665-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARF4/ADP-ribosylation factor 4 Reagents
CRO Services
Product recommended

All ARF4/ADP-ribosylation factor 4 Reagents
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Human ADP-ribosylation factor 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-HA tag Alternative Names
ARF2 cDNA ORF Clone, Human
ARF4/ADP-ribosylation factor 4 Background Information
Full Name
ADP-ribosylation factor 4

ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone in Cloning Vector, Ferret FG60072-G
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, untagged FG60072-UT
ARF4/ADP-ribosylation factor 4 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60072-ACGLN
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60072-ACG
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60072-ANG
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60072-ACR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60072-ANR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60072-CF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60072-NF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-His tag FG60072-CH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-His tag FG60072-NH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-HA tag FG60072-CY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-HA tag FG60072-NY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, C-Myc tag FG60072-CM
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Ferret, N-Myc tag FG60072-NM

ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone in Cloning Vector, Rat RG81000-U
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, untagged RG81000-UT
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81000-ACG
ARF4/ADP-ribosylation factor 4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81000-ACGLN
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81000-ACR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81000-CF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81000-NF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-His tag RG81000-CH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, N-His tag RG81000-NH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-HA tag RG81000-CY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, N-HA tag RG81000-NY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, C-Myc tag RG81000-CM
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Rat, N-Myc tag RG81000-NM
ARF4/ADP-ribosylation factor 4 qPCR Primer Pairs, Rat RP300964

ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone in Cloning Vector, Mouse MG52281-G
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, untagged MG52281-UT
ARF4/ADP-ribosylation factor 4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52281-ACGLN
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52281-ACG
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52281-ANG
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52281-ACR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52281-ANR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52281-CF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52281-NF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-His tag MG52281-CH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-His tag MG52281-NH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-HA tag MG52281-CY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-HA tag MG52281-NY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, C-Myc tag MG52281-CM
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Mouse, N-Myc tag MG52281-NM
ARF4/ADP-ribosylation factor 4 qPCR Primer Pairs, Mouse MP202154

ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone in Cloning Vector, Human HG14665-G
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, untagged HG14665-UT
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14665-ACG
ARF4/ADP-ribosylation factor 4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14665-ACGLN
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14665-ACR
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14665-CF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14665-NF
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-His tag HG14665-CH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-His tag HG14665-NH
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-HA tag HG14665-CY
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, C-Myc tag HG14665-CM
ARF4/ADP-ribosylation factor 4 cDNA ORF Clone, Human, N-Myc tag HG14665-NM
ARF4/ADP-ribosylation factor 4 qPCR Primer Pairs, Human HP103299
info info
添加购物车成功! 添加购物车失败!