ARF3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14967-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARF3 Reagents
CRO Services
Product recommended

All ARF3 Reagents
ARF3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Human ADP-ribosylation factor 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF3 Background Information

ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

Full Name
ADP-ribosylation factor 3
References
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • ARF3 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    ARF3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90751-G
    ARF3 cDNA ORF Clone, Cynomolgus, untagged CG90751-UT
    ARF3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90751-ACG
    ARF3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90751-ACGLN
    ARF3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90751-ACR
    ARF3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90751-CF
    ARF3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90751-NF
    ARF3 cDNA ORF Clone, Cynomolgus, C-His tag CG90751-CH
    ARF3 cDNA ORF Clone, Cynomolgus, N-His tag CG90751-NH
    ARF3 cDNA ORF Clone, Cynomolgus, C-HA tag CG90751-CY
    ARF3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90751-NY
    ARF3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90751-CM
    ARF3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90751-NM

    ARF3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ARF3 cDNA ORF Clone in Cloning Vector, Mouse MG5A4541-U
    ARF3 cDNA ORF Clone, Mouse, untagged MG5A4541-UT
    ARF3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4541-ACG
    ARF3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4541-ACGLN
    ARF3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4541-ANG
    ARF3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4541-ACR
    ARF3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4541-ANR
    ARF3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4541-CF
    ARF3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4541-NF
    ARF3 cDNA ORF Clone, Mouse, C-His tag MG5A4541-CH
    ARF3 cDNA ORF Clone, Mouse, N-His tag MG5A4541-NH
    ARF3 cDNA ORF Clone, Mouse, C-HA tag MG5A4541-CY
    ARF3 cDNA ORF Clone, Mouse, N-HA tag MG5A4541-NY
    ARF3 cDNA ORF Clone, Mouse, C-Myc tag MG5A4541-CM
    ARF3 cDNA ORF Clone, Mouse, N-Myc tag MG5A4541-NM

    ARF3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ARF3 cDNA ORF Clone in Cloning Vector, Human HG14967-G
    ARF3 cDNA ORF Clone, Human, untagged HG14967-UT
    ARF3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14967-ACG
    ARF3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14967-ACGLN
    ARF3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14967-ACR
    ARF3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14967-CF
    ARF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14967-NF
    ARF3 cDNA ORF Clone, Human, C-His tag HG14967-CH
    ARF3 cDNA ORF Clone, Human, N-His tag HG14967-NH
    ARF3 cDNA ORF Clone, Human, C-HA tag HG14967-CY
    ARF3 cDNA ORF Clone, Human, N-HA tag HG14967-NY
    ARF3 cDNA ORF Clone, Human, C-Myc tag HG14967-CM
    ARF3 qPCR Primer Pairs, Human HP103596
    info info
    添加购物车成功! 添加购物车失败!