Amphiregulin cDNA ORF Clone, Human, N-HA tag

Cat: HG10558-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Amphiregulin Reagents
CRO Services
Product recommended

All Amphiregulin Reagents
Amphiregulin cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
759 bp
Description
Full length Clone DNA of Human amphiregulin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Amphiregulin cDNA ORF Clone, Human, N-HA tag Alternative Names
AR cDNA ORF Clone, Human;AREGB cDNA ORF Clone, Human;CRDGF cDNA ORF Clone, Human;SDGF cDNA ORF Clone, Human
Amphiregulin Background Information

Amphiregulin(AREG), also known as colorectum cell-derived growth factor, CRDGF, SDGF and AREG, is a member of the epidermal growth factor family and the amphiregulin family. Members of EGF family are cytokines that include 10 proteins such as EGF, TGFb, HBEGF, and the various heregulins. Amphiregulin is a single-pass membrane protein and contains one EGF-like domain. It plays a key role in epithelial development in various organs. Amphiregulin has a realationship with epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). It is an autocrine growth factor as well as a mitogen for astrocytes, Schwann cells, and fibroblasts. As a bifunctional growth-modulating glycoprotein, amphiregulin inhibits growth of several human carcinoma cells in culture and stimulates proliferation of human fibroblasts and certain other tumor cells. Amphiregulin also may play a protective role in bleomycin-induced pneumopathy, probably through the activation of survival signals.

Full Name
amphiregulin
References
  • Shoyab M, et al. (1989) Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 243 (4894): 1074-6.
  • Plowman GD, et al. (1990) The amphiregulin gene encodes a novel epidermal growth factor-related protein with tumor-inhibitory activity. Mol Cell Biol. 10 (5): 1969-81.
  • Culouscou JM, et al. (1993) Colorectum cell-derived growth factor (CRDGF) is homologous to amphiregulin, a member of the epidermal growth factor family. Growth Factors. 7 (3): 195-205.
  • Amphiregulin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Amphiregulin cDNA ORF Clone in Cloning Vector, Mouse MG51137-G
    Amphiregulin cDNA ORF Clone, Mouse, untagged MG51137-UT
    Amphiregulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51137-ACGLN
    Amphiregulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51137-ACG
    Amphiregulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51137-ACR
    Amphiregulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51137-CF
    Amphiregulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51137-NF
    Amphiregulin cDNA ORF Clone, Mouse, C-His tag MG51137-CH
    Amphiregulin cDNA ORF Clone, Mouse, N-His tag MG51137-NH
    Amphiregulin cDNA ORF Clone, Mouse, C-HA tag MG51137-CY
    Amphiregulin cDNA ORF Clone, Mouse, N-HA tag MG51137-NY
    Amphiregulin cDNA ORF Clone, Mouse, C-Myc tag MG51137-CM
    Amphiregulin cDNA ORF Clone, Mouse, N-Myc tag MG51137-NM

    Amphiregulin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Amphiregulin cDNA ORF Clone in Cloning Vector, Human HG10558-M
    Amphiregulin cDNA ORF Clone, Human, untagged HG10558-UT
    Amphiregulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10558-ACGLN
    Amphiregulin cDNA ORF Clone, Human, C-GFPSpark® tag HG10558-ACG
    Amphiregulin cDNA ORF Clone, Human, C-OFPSpark® tag HG10558-ACR
    Amphiregulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10558-CF
    Amphiregulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10558-NF
    Amphiregulin cDNA ORF Clone, Human, C-His tag HG10558-CH
    Amphiregulin cDNA ORF Clone, Human, N-His tag HG10558-NH
    Amphiregulin cDNA ORF Clone, Human, C-HA tag HG10558-CY
    Amphiregulin cDNA ORF Clone, Human, C-Myc tag HG10558-CM
    Amphiregulin cDNA ORF Clone, Human, N-Myc tag HG10558-NM
    Amphiregulin qPCR Primer Pairs, Human HP100570
    info info
    添加购物车成功! 添加购物车失败!