ARAF cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12209-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARAF Reagents
CRO Services
Product recommended

All ARAF Reagents
ARAF cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1821 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-raf murine sarcoma 3611 viral oncogene homolog with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
HindIII + NotI (6kb + 1.86kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ARAF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARAF cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human STAT3 Gene Plasmid Map 5651
Human ARAF Gene Expression validated Image 16483
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ARAF cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
A-RAF cDNA ORF Clone, Human;ARAF1 cDNA ORF Clone, Human;PKS2 cDNA ORF Clone, Human;RAFA1 cDNA ORF Clone, Human
ARAF Background Information
Full Name
A-Raf proto-oncogene, serine/threonine kinase

ARAF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARAF cDNA ORF Clone in Cloning Vector, Mouse MG52075-G
ARAF cDNA ORF Clone, Mouse, untagged MG52075-UT
ARAF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52075-ACG
ARAF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52075-ACGLN
ARAF cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52075-ANG
ARAF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52075-ACR
ARAF cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52075-ANR
ARAF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52075-CF
ARAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52075-NF
ARAF cDNA ORF Clone, Mouse, C-His tag MG52075-CH
ARAF cDNA ORF Clone, Mouse, N-His tag MG52075-NH
ARAF cDNA ORF Clone, Mouse, C-HA tag MG52075-CY
ARAF cDNA ORF Clone, Mouse, N-HA tag MG52075-NY
ARAF cDNA ORF Clone, Mouse, C-Myc tag MG52075-CM
ARAF cDNA ORF Clone, Mouse, N-Myc tag MG52075-NM
ARAF qPCR Primer Pairs, Mouse MP201948

ARAF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARAF cDNA ORF Clone in Cloning Vector, Human HG12209-G
ARAF cDNA ORF Clone, Human, untagged HG12209-UT
ARAF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12209-ACGLN
ARAF cDNA ORF Clone, Human, C-GFPSpark® tag HG12209-ACG
ARAF cDNA ORF Clone, Human, N-GFPSpark® tag HG12209-ANG
ARAF cDNA ORF Clone, Human, C-OFPSpark® tag HG12209-ACR
ARAF cDNA ORF Clone, Human, N-OFPSpark® tag HG12209-ANR
ARAF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12209-CF
ARAF cDNA ORF Clone, Human, C-His tag HG12209-CH
ARAF cDNA ORF Clone, Human, N-His tag HG12209-NH
ARAF cDNA ORF Clone, Human, C-HA tag HG12209-CY
ARAF cDNA ORF Clone, Human, N-HA tag HG12209-NY
ARAF cDNA ORF Clone, Human, C-Myc tag HG12209-CM
ARAF cDNA ORF Clone, Human, N-Myc tag HG12209-NM
ARAF qPCR Primer Pairs, Human HP101849
info info
添加购物车成功! 添加购物车失败!