Amyloid Precursor Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10703-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Amyloid Precursor Protein Reagents
CRO Services
Product recommended

All Amyloid Precursor Protein Reagents
Amyloid Precursor Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2256 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human amyloid beta (A4) precursor protein (APP), transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
HindIII + XbaI (6kb + 2.29kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Amyloid Precursor Protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Amyloid Precursor Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5623
Amyloid Precursor Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
AAA cDNA ORF Clone, Human;ABETA cDNA ORF Clone, Human;ABPP cDNA ORF Clone, Human;AD1 cDNA ORF Clone, Human;APPI cDNA ORF Clone, Human;CTFgamma cDNA ORF Clone, Human;CVAP cDNA ORF Clone, Human;PN-II cDNA ORF Clone, Human;PN2 cDNA ORF Clone, Human
Amyloid Precursor Protein Background Information

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

Full Name
amyloid beta (A4) precursor protein
References
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • Amyloid Precursor Protein cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Amyloid Precursor Protein cDNA ORF Clone in Cloning Vector, Mouse MG50402-M
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, untagged MG5A7634-UT
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, untagged MG50402-UT
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50402-ACG
    Amyloid Precursor Protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50402-ACGLN
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50402-ACR
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50402-CF
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50402-NF
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-His tag MG50402-CH
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, N-His tag MG50402-NH
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-HA tag MG50402-CY
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, N-HA tag MG50402-NY
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, C-Myc tag MG50402-CM
    Amyloid Precursor Protein cDNA ORF Clone, Mouse, N-Myc tag MG50402-NM
    Amyloid Precursor Protein qPCR Primer Pairs, Mouse MP200419

    Amyloid Precursor Protein cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Amyloid Precursor Protein cDNA ORF Clone in Cloning Vector, Human HG10703-M
    Amyloid Precursor Protein cDNA ORF Clone, Human, untagged HG10703-UT
    Amyloid Precursor Protein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10703-ACGLN
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-GFPSpark® tag HG10703-ACG
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-OFPSpark® tag HG10703-ACR
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10703-CF
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-His tag HG10703-CH
    Amyloid Precursor Protein cDNA ORF Clone, Human, N-His tag HG10703-NH
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-HA tag HG10703-CY
    Amyloid Precursor Protein cDNA ORF Clone, Human, N-HA tag HG10703-NY
    Amyloid Precursor Protein cDNA ORF Clone, Human, C-Myc tag HG10703-CM
    Amyloid Precursor Protein cDNA ORF Clone, Human, N-Myc tag HG10703-NM
    Amyloid Precursor Protein qPCR Primer Pairs, Human HP100882
    info info
    添加购物车成功! 添加购物车失败!