APOA1BP cDNA ORF Clone, Human, C-His tag

Cat: HG13421-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All APOA1BP Reagents
CRO Services
Product recommended

All APOA1BP Reagents
APOA1BP cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Human apolipoprotein A-I binding protein
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APOA1BP cDNA ORF Clone, Human, C-His tag Alternative Names
AIBP cDNA ORF Clone, Human;YJEFN1 cDNA ORF Clone, Human
APOA1BP Background Information
Full Name
apolipoprotein A-I binding protein

APOA1BP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
APOA1BP cDNA ORF Clone in Cloning Vector, Mouse MG53208-G
APOA1BP cDNA ORF Clone, Mouse, untagged MG53208-UT
APOA1BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53208-ACGLN
APOA1BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53208-ACG
APOA1BP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53208-ANG
APOA1BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53208-ACR
APOA1BP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53208-ANR
APOA1BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53208-CF
APOA1BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53208-NF
APOA1BP cDNA ORF Clone, Mouse, C-His tag MG53208-CH
APOA1BP cDNA ORF Clone, Mouse, N-His tag MG53208-NH
APOA1BP cDNA ORF Clone, Mouse, C-HA tag MG53208-CY
APOA1BP cDNA ORF Clone, Mouse, N-HA tag MG53208-NY
APOA1BP cDNA ORF Clone, Mouse, C-Myc tag MG53208-CM
APOA1BP cDNA ORF Clone, Mouse, N-Myc tag MG53208-NM

APOA1BP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APOA1BP cDNA ORF Clone in Cloning Vector, Human HG13421-G
APOA1BP cDNA ORF Clone, Human, untagged HG13421-UT
APOA1BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13421-ACGLN
APOA1BP cDNA ORF Clone, Human, C-GFPSpark® tag HG13421-ACG
APOA1BP cDNA ORF Clone, Human, N-GFPSpark® tag HG13421-ANG
APOA1BP cDNA ORF Clone, Human, C-OFPSpark® tag HG13421-ACR
APOA1BP cDNA ORF Clone, Human, N-OFPSpark® tag HG13421-ANR
APOA1BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13421-CF
APOA1BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13421-NF
APOA1BP cDNA ORF Clone, Human, N-His tag HG13421-NH
APOA1BP cDNA ORF Clone, Human, C-HA tag HG13421-CY
APOA1BP cDNA ORF Clone, Human, N-HA tag HG13421-NY
APOA1BP cDNA ORF Clone, Human, C-Myc tag HG13421-CM
APOA1BP cDNA ORF Clone, Human, N-Myc tag HG13421-NM
APOA1BP qPCR Primer Pairs, Human HP102122
info info
添加购物车成功! 添加购物车失败!