Apolipoprotein A-I cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10686-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Apolipoprotein A-I Reagents
CRO Services
Product recommended

All Apolipoprotein A-I Reagents
Apolipoprotein A-I cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
804 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human apolipoprotein A-I with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.84kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Apolipoprotein A-I cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Apolipoprotein A-I cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human Apolipoprotein A-I/ApoA1 Gene Expression validated Image 16153
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Apolipoprotein A-I cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
Apolipoprotein A-I cDNA ORF Clone, Human
Apolipoprotein A-I Background Information

Apolipoprotein A1 (APOA1) is a member of the apolipoprotein family whose members are proteins bind with lipids and form lipoproteins to translate these oil-soluble lipids such as fat and cholesterol through lymphatic and circulatory system. APOA1 is the main component of high density lipoprotein (HDL) in plasma and is involved in the esterification of cholesterol as a cofactor of lecithin-cholesterol acyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters, and thus play a major role in cholesterol efflux from peripheral cells. As a major component of the HDL complex, APOA1 helps to clear cholesterol from arteries. APOA1 is also characterized as a prostacyclin stabilizing factor, and thus may have an anticlotting effect. Defects in encoding gene may result in HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. Men carrying a mutation may develop premature coronary artery disease.

Full Name
apolipoprotein A-I
References
  • Toptas B, et al. (2011) Comparison of lipid profiles with APOA1 MspI polymorphism in obese children with hyperlipidemia. In Vivo. 25(3): 425-30.
  • Haase CL, et al. (2011) Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. J Intern Med. 270(2): 136-46.
  • Wu Z, et al. (2011) The low resolution structure of ApoA1 in spherical high density lipoprotein revealed small angle neutron scattering. J Biol Chem. 286(14): 12495-508.
  • Apolipoprotein A-I cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein A-I cDNA ORF Clone in Cloning Vector, Rat RG80793-U
    Apolipoprotein A-I cDNA ORF Clone, Rat, untagged RG80793-UT
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-GFPSpark® tag RG80793-ACG
    Apolipoprotein A-I Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80793-ACGLN
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-OFPSpark® tag RG80793-ACR
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80793-CF
    Apolipoprotein A-I cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80793-NF
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-His tag RG80793-CH
    Apolipoprotein A-I cDNA ORF Clone, Rat, N-His tag RG80793-NH
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-HA tag RG80793-CY
    Apolipoprotein A-I cDNA ORF Clone, Rat, N-HA tag RG80793-NY
    Apolipoprotein A-I cDNA ORF Clone, Rat, C-Myc tag RG80793-CM
    Apolipoprotein A-I cDNA ORF Clone, Rat, N-Myc tag RG80793-NM
    Apolipoprotein A-I qPCR Primer Pairs, Rat RP300757

    Apolipoprotein A-I cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein A-I cDNA ORF Clone in Cloning Vector, Mouse MG53232-G
    Apolipoprotein A-I cDNA ORF Clone, Mouse, untagged MG53232-UT
    Apolipoprotein A-I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53232-ACGLN
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53232-ACG
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53232-ACR
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53232-CF
    Apolipoprotein A-I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53232-NF
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-His tag MG53232-CH
    Apolipoprotein A-I cDNA ORF Clone, Mouse, N-His tag MG53232-NH
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-HA tag MG53232-CY
    Apolipoprotein A-I cDNA ORF Clone, Mouse, N-HA tag MG53232-NY
    Apolipoprotein A-I cDNA ORF Clone, Mouse, C-Myc tag MG53232-CM
    Apolipoprotein A-I cDNA ORF Clone, Mouse, N-Myc tag MG53232-NM
    Apolipoprotein A-I qPCR Primer Pairs, Mouse MP200887

    Apolipoprotein A-I cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Apolipoprotein A-I cDNA ORF Clone in Cloning Vector, Human HG10686-M
    Apolipoprotein A-I cDNA ORF Clone, Human, untagged HG10686-UT
    Apolipoprotein A-I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10686-ACGLN
    Apolipoprotein A-I cDNA ORF Clone, Human, C-GFPSpark® tag HG10686-ACG
    Apolipoprotein A-I cDNA ORF Clone, Human, C-OFPSpark® tag HG10686-ACR
    Apolipoprotein A-I cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10686-CF
    Apolipoprotein A-I cDNA ORF Clone, Human, C-His tag HG10686-CH
    Apolipoprotein A-I cDNA ORF Clone, Human, N-His tag HG10686-NH
    Apolipoprotein A-I cDNA ORF Clone, Human, C-HA tag HG10686-CY
    Apolipoprotein A-I cDNA ORF Clone, Human, N-HA tag HG10686-NY
    Apolipoprotein A-I cDNA ORF Clone, Human, C-Myc tag HG10686-CM
    Apolipoprotein A-I cDNA ORF Clone, Human, N-Myc tag HG10686-NM
    Apolipoprotein A-I qPCR Primer Pairs, Human HP100648
    info info
    添加购物车成功! 添加购物车失败!