XRCC1/APLF cDNA ORF Clone, Human, N-HA tag

Cat: HG15275-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All XRCC1/APLF Reagents
CRO Services
Product recommended

All XRCC1/APLF Reagents
XRCC1/APLF cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Human aprataxin and PNKP like factor with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XRCC1/APLF cDNA ORF Clone, Human, N-HA tag Alternative Names
APFL cDNA ORF Clone, Human;C2orf13 cDNA ORF Clone, Human;PALF cDNA ORF Clone, Human;Xip1 cDNA ORF Clone, Human;ZCCHH1 cDNA ORF Clone, Human
XRCC1/APLF Background Information
Full Name
aprataxin and PNKP like factor

XRCC1/APLF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
XRCC1/APLF cDNA ORF Clone in Cloning Vector, Mouse MG53727-U
XRCC1/APLF cDNA ORF Clone, Mouse, untagged MG53727-UT
XRCC1/APLF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53727-ACGLN
XRCC1/APLF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53727-ACG
XRCC1/APLF cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53727-ANG
XRCC1/APLF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53727-ACR
XRCC1/APLF cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53727-ANR
XRCC1/APLF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53727-CF
XRCC1/APLF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53727-NF
XRCC1/APLF cDNA ORF Clone, Mouse, C-His tag MG53727-CH
XRCC1/APLF cDNA ORF Clone, Mouse, N-His tag MG53727-NH
XRCC1/APLF cDNA ORF Clone, Mouse, C-HA tag MG53727-CY
XRCC1/APLF cDNA ORF Clone, Mouse, N-HA tag MG53727-NY
XRCC1/APLF cDNA ORF Clone, Mouse, C-Myc tag MG53727-CM
XRCC1/APLF cDNA ORF Clone, Mouse, N-Myc tag MG53727-NM

XRCC1/APLF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
XRCC1/APLF cDNA ORF Clone in Cloning Vector, Human HG15275-G
XRCC1/APLF cDNA ORF Clone, Human, untagged HG15275-UT
XRCC1/APLF cDNA ORF Clone, Human, C-GFPSpark® tag HG15275-ACG
XRCC1/APLF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15275-ACGLN
XRCC1/APLF cDNA ORF Clone, Human, N-GFPSpark® tag HG15275-ANG
XRCC1/APLF cDNA ORF Clone, Human, C-OFPSpark® tag HG15275-ACR
XRCC1/APLF cDNA ORF Clone, Human, N-OFPSpark® tag HG15275-ANR
XRCC1/APLF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15275-CF
XRCC1/APLF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15275-NF
XRCC1/APLF cDNA ORF Clone, Human, C-His tag HG15275-CH
XRCC1/APLF cDNA ORF Clone, Human, N-His tag HG15275-NH
XRCC1/APLF cDNA ORF Clone, Human, C-HA tag HG15275-CY
XRCC1/APLF cDNA ORF Clone, Human, C-Myc tag HG15275-CM
XRCC1/APLF cDNA ORF Clone, Human, N-Myc tag HG15275-NM
XRCC1/APLF qPCR Primer Pairs, Human HP103901
info info
添加购物车成功! 添加购物车失败!