API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-His tag

Cat: HG16357-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All API5/Apoptosis inhibitor 5 Reagents
CRO Services
Product recommended

All API5/Apoptosis inhibitor 5 Reagents
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1575 bp
Description
Full length Clone DNA of Human apoptosis inhibitor 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-His tag Alternative Names
AAC-11 cDNA ORF Clone, Human;AAC11 cDNA ORF Clone, Human
API5/Apoptosis inhibitor 5 Background Information
Full Name
apoptosis inhibitor 5

API5/Apoptosis inhibitor 5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
API5/Apoptosis inhibitor 5 cDNA ORF Clone in Cloning Vector, Rat RG87876-U
API5/Apoptosis inhibitor 5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87876-ACGLN

API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
API5/Apoptosis inhibitor 5 cDNA ORF Clone in Cloning Vector, Mouse MG5A3009-U
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, untagged MG5A3009-UT
API5/Apoptosis inhibitor 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3009-ACGLN
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3009-ACG
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3009-ANG
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3009-ACR
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3009-ANR
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3009-CF
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3009-NF
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-His tag MG5A3009-CH
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-His tag MG5A3009-NH
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-HA tag MG5A3009-CY
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-HA tag MG5A3009-NY
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, C-Myc tag MG5A3009-CM
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Mouse, N-Myc tag MG5A3009-NM

API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
API5/Apoptosis inhibitor 5 cDNA ORF Clone in Cloning Vector, Human HG16357-G
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, untagged HG16357-UT
API5/Apoptosis inhibitor 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16357-ACGLN
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16357-ACG
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16357-ANG
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16357-ACR
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16357-ANR
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16357-CF
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16357-NF
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-His tag HG16357-NH
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-HA tag HG16357-CY
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-HA tag HG16357-NY
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, C-Myc tag HG16357-CM
API5/Apoptosis inhibitor 5 cDNA ORF Clone, Human, N-Myc tag HG16357-NM
API5/Apoptosis inhibitor 5 qPCR Primer Pairs, Human HP105109
info info
添加购物车成功! 添加购物车失败!