APBA2 cDNA ORF Clone, Human, N-HA tag

Cat: HG11164-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All APBA2 Reagents

CRO Services

Product recommended


All APBA2 Reagents

APBA2 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2250 bp
Description
Full length Clone DNA of Human amyloid beta (A4) precursor protein-binding, family A, member 2 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APBA2 cDNA ORF Clone, Human, N-HA tag Alternative Names

D15S1518E cDNA ORF Clone, Human;HsT16821 cDNA ORF Clone, Human;LIN-10 cDNA ORF Clone, Human;MGC:14091 cDNA ORF Clone, Human;MINT2 cDNA ORF Clone, Human;X11-BETA cDNA ORF Clone, Human;X11L cDNA ORF Clone, Human

APBA2 Background Information

Full Name
amyloid beta (A4) precursor protein-binding, family A, member 2

APBA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
APBA2 cDNA ORF Clone in Cloning Vector, Mouse MG52045-G
APBA2 cDNA ORF Clone, Mouse, untagged MG52045-UT
APBA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52045-ACGLN
APBA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52045-ACG
APBA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52045-ANG
APBA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52045-ACR
APBA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52045-ANR
APBA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52045-CF
APBA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52045-NF
APBA2 cDNA ORF Clone, Mouse, C-His tag MG52045-CH
APBA2 cDNA ORF Clone, Mouse, N-His tag MG52045-NH
APBA2 cDNA ORF Clone, Mouse, C-HA tag MG52045-CY
APBA2 cDNA ORF Clone, Mouse, N-HA tag MG52045-NY
APBA2 cDNA ORF Clone, Mouse, C-Myc tag MG52045-CM
APBA2 cDNA ORF Clone, Mouse, N-Myc tag MG52045-NM
APBA2 qPCR Primer Pairs, Mouse MP201918

APBA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APBA2 cDNA ORF Clone in Cloning Vector, Human HG11164-M
APBA2 cDNA ORF Clone, Human, untagged HG11164-UT
APBA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11164-ACGLN
APBA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11164-ACG
APBA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11164-ANG
APBA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11164-ACR
APBA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11164-ANR
APBA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11164-CF
APBA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11164-NF
APBA2 cDNA ORF Clone, Human, C-His tag HG11164-CH
APBA2 cDNA ORF Clone, Human, N-His tag HG11164-NH
APBA2 cDNA ORF Clone, Human, C-HA tag HG11164-CY
APBA2 cDNA ORF Clone, Human, C-Myc tag HG11164-CM
APBA2 cDNA ORF Clone, Human, N-Myc tag HG11164-NM
APBA2 qPCR Primer Pairs, Human HP101071
info info
添加购物车成功! 添加购物车失败!