Annexin A2/ANXA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13517-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Annexin A2/ANXA2 Reagents
CRO Services
Product recommended

All Annexin A2/ANXA2 Reagents
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1020 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human annexin A2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Annexin A2/ANXA2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin A2/ANXA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human Annexin A2/ANXA2 Gene Expression validated Image 16237
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ANX2 cDNA ORF Clone, Human;ANX2L4 cDNA ORF Clone, Human;CAL1H cDNA ORF Clone, Human;HEL-S-270 cDNA ORF Clone, Human;LIP2 cDNA ORF Clone, Human;LPC2 cDNA ORF Clone, Human;LPC2D cDNA ORF Clone, Human;P36 cDNA ORF Clone, Human;PAP-IV cDNA ORF Clone, Human
Annexin A2/ANXA2 Background Information
Full Name
annexin A2

Annexin A2/ANXA2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Ferret FG60086-G
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, untagged FG60086-UT
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60086-ACG
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60086-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60086-ANG
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60086-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60086-ANR
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60086-CF
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60086-NF
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-His tag FG60086-CH
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-His tag FG60086-NH
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-HA tag FG60086-CY
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-HA tag FG60086-NY
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, C-Myc tag FG60086-CM
Annexin A2/ANXA2 cDNA ORF Clone, Ferret, N-Myc tag FG60086-NM

Annexin A2/ANXA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Rat RG80644-U
Annexin A2/ANXA2 cDNA ORF Clone, Rat, untagged RG80644-UT
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80644-ACG
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80644-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80644-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80644-CF
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80644-NF
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-His tag RG80644-CH
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-His tag RG80644-NH
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-HA tag RG80644-CY
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-HA tag RG80644-NY
Annexin A2/ANXA2 cDNA ORF Clone, Rat, C-Myc tag RG80644-CM
Annexin A2/ANXA2 cDNA ORF Clone, Rat, N-Myc tag RG80644-NM
Annexin A2/ANXA2 qPCR Primer Pairs, Rat RP300608

Annexin A2/ANXA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Mouse MG52756-G
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, untagged MG52756-UT
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52756-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52756-ACG
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52756-ANG
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52756-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52756-ANR
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52756-CF
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52756-NF
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-His tag MG52756-CH
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-His tag MG52756-NH
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-HA tag MG52756-CY
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-HA tag MG52756-NY
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, C-Myc tag MG52756-CM
Annexin A2/ANXA2 cDNA ORF Clone, Mouse, N-Myc tag MG52756-NM

Annexin A2/ANXA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Annexin A2/ANXA2 cDNA ORF Clone in Cloning Vector, Human HG13517-G
Annexin A2/ANXA2 cDNA ORF Clone, Human, untagged HG13517-UT
Annexin A2/ANXA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13517-ACGLN
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13517-ACG
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13517-ACR
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13517-CF
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-His tag HG13517-CH
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-His tag HG13517-NH
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-HA tag HG13517-CY
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-HA tag HG13517-NY
Annexin A2/ANXA2 cDNA ORF Clone, Human, C-Myc tag HG13517-CM
Annexin A2/ANXA2 cDNA ORF Clone, Human, N-Myc tag HG13517-NM
Annexin A2/ANXA2 qPCR Primer Pairs, Human HP102204
info info
添加购物车成功! 添加购物车失败!