ANTXR2 cDNA ORF Clone, Human, C-HA tag

Cat: HG15762-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ANTXR2 Reagents

CRO Services

Product recommended


All ANTXR2 Reagents

ANTXR2 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1470 bp
Description
Full length Clone DNA of Human anthrax toxin receptor 2 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANTXR2 cDNA ORF Clone, Human, C-HA tag Alternative Names

CMG-2 cDNA ORF Clone, Human;CMG2 cDNA ORF Clone, Human;HFS cDNA ORF Clone, Human;ISH cDNA ORF Clone, Human;JHF cDNA ORF Clone, Human

ANTXR2 Background Information

Full Name
anthrax toxin receptor 2

ANTXR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANTXR2 cDNA ORF Clone in Cloning Vector, Mouse MG51131-G
ANTXR2 cDNA ORF Clone, Mouse, untagged MG51131-UT
ANTXR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51131-ACG
ANTXR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51131-ACGLN
ANTXR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51131-ACR
ANTXR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51131-CF
ANTXR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51131-NF
ANTXR2 cDNA ORF Clone, Mouse, C-His tag MG51131-CH
ANTXR2 cDNA ORF Clone, Mouse, N-His tag MG51131-NH
ANTXR2 cDNA ORF Clone, Mouse, C-HA tag MG51131-CY
ANTXR2 cDNA ORF Clone, Mouse, N-HA tag MG51131-NY
ANTXR2 cDNA ORF Clone, Mouse, C-Myc tag MG51131-CM
ANTXR2 cDNA ORF Clone, Mouse, N-Myc tag MG51131-NM

ANTXR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANTXR2 cDNA ORF Clone in Cloning Vector, Human HG29614-U
ANTXR2 cDNA ORF Clone in Cloning Vector, Human HG15762-G
ANTXR2 cDNA ORF Clone, Human, untagged HG29614-UT
ANTXR2 cDNA ORF Clone, Human, untagged HG15762-UT
ANTXR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG29614-ACG
ANTXR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15762-ACGLN
ANTXR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15762-ACG
ANTXR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29614-ACGLN
ANTXR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15762-ACR
ANTXR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG29614-ACR
ANTXR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15762-CF
ANTXR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29614-CF
ANTXR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15762-NF
ANTXR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29614-NF
ANTXR2 cDNA ORF Clone, Human, C-His tag HG15762-CH
ANTXR2 cDNA ORF Clone, Human, C-His tag HG29614-CH
ANTXR2 cDNA ORF Clone, Human, N-His tag HG15762-NH
ANTXR2 cDNA ORF Clone, Human, N-His tag HG29614-NH
ANTXR2 cDNA ORF Clone, Human, C-HA tag HG29614-CY
ANTXR2 cDNA ORF Clone, Human, N-HA tag HG29614-NY
ANTXR2 cDNA ORF Clone, Human, N-HA tag HG15762-NY
ANTXR2 cDNA ORF Clone, Human, C-Myc tag HG29614-CM
ANTXR2 cDNA ORF Clone, Human, C-Myc tag HG15762-CM
ANTXR2 cDNA ORF Clone, Human, N-Myc tag HG15762-NM
ANTXR2 cDNA ORF Clone, Human, N-Myc tag HG29614-NM
ANTXR2 qPCR Primer Pairs, Human HP104354
info info
添加购物车成功! 添加购物车失败!