ANKRD1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14444-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANKRD1 Reagents
CRO Services
Product recommended

All ANKRD1 Reagents
ANKRD1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
960 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ankyrin repeat domain 1 (cardiac muscle) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Restriction Sites
KpnI + XbaI (6kb + 1.01kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ANKRD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANKRD1 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human bFGF/FGF2 Gene Plasmid Map 5639
ANKRD1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALRP cDNA ORF Clone, Human;bA320F15.2 cDNA ORF Clone, Human;C-193 cDNA ORF Clone, Human;CARP cDNA ORF Clone, Human;CVARP cDNA ORF Clone, Human;MCARP cDNA ORF Clone, Human
ANKRD1 Background Information
Full Name
ankyrin repeat domain 1 (cardiac muscle)

ANKRD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANKRD1 cDNA ORF Clone in Cloning Vector, Mouse MG53601-U
ANKRD1 cDNA ORF Clone, Mouse, untagged MG53601-UT
ANKRD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53601-ACG
ANKRD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53601-ACGLN
ANKRD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53601-ANG
ANKRD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53601-ACR
ANKRD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53601-ANR
ANKRD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53601-CF
ANKRD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53601-NF
ANKRD1 cDNA ORF Clone, Mouse, C-His tag MG53601-CH
ANKRD1 cDNA ORF Clone, Mouse, N-His tag MG53601-NH
ANKRD1 cDNA ORF Clone, Mouse, C-HA tag MG53601-CY
ANKRD1 cDNA ORF Clone, Mouse, N-HA tag MG53601-NY
ANKRD1 cDNA ORF Clone, Mouse, C-Myc tag MG53601-CM
ANKRD1 cDNA ORF Clone, Mouse, N-Myc tag MG53601-NM

ANKRD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANKRD1 cDNA ORF Clone in Cloning Vector, Human HG14444-G
ANKRD1 cDNA ORF Clone, Human, untagged HG14444-UT
ANKRD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14444-ACG
ANKRD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14444-ACGLN
ANKRD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14444-ANG
ANKRD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14444-ACR
ANKRD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14444-ANR
ANKRD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14444-CF
ANKRD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14444-NF
ANKRD1 cDNA ORF Clone, Human, C-His tag HG14444-CH
ANKRD1 cDNA ORF Clone, Human, N-His tag HG14444-NH
ANKRD1 cDNA ORF Clone, Human, C-HA tag HG14444-CY
ANKRD1 cDNA ORF Clone, Human, N-HA tag HG14444-NY
ANKRD1 cDNA ORF Clone, Human, C-Myc tag HG14444-CM
ANKRD1 qPCR Primer Pairs, Human HP103092
info info
添加购物车成功! 添加购物车失败!