ANKRA2 cDNA ORF Clone, Human, C-HA tag

Cat: HG14711-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANKRA2 Reagents
CRO Services
Product recommended

All ANKRA2 Reagents
ANKRA2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Human ankyrin repeat, family A (RFXANK-like), 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANKRA2 cDNA ORF Clone, Human, C-HA tag Alternative Names
ANKRA cDNA ORF Clone, Human
ANKRA2 Background Information
Full Name
ankyrin repeat, family A (RFXANK-like), 2

ANKRA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ANKRA2 cDNA ORF Clone in Cloning Vector, Rat RG80888-U
ANKRA2 cDNA ORF Clone, Rat, untagged RG80888-UT
ANKRA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80888-ACGLN
ANKRA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80888-ACG
ANKRA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80888-ANG
ANKRA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80888-ACR
ANKRA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80888-ANR
ANKRA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80888-CF
ANKRA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80888-NF
ANKRA2 cDNA ORF Clone, Rat, C-His tag RG80888-CH
ANKRA2 cDNA ORF Clone, Rat, N-His tag RG80888-NH
ANKRA2 cDNA ORF Clone, Rat, C-HA tag RG80888-CY
ANKRA2 cDNA ORF Clone, Rat, N-HA tag RG80888-NY
ANKRA2 cDNA ORF Clone, Rat, C-Myc tag RG80888-CM
ANKRA2 cDNA ORF Clone, Rat, N-Myc tag RG80888-NM
ANKRA2 qPCR Primer Pairs, Rat RP300852

ANKRA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANKRA2 cDNA ORF Clone in Cloning Vector, Mouse MG51956-G
ANKRA2 cDNA ORF Clone, Mouse, untagged MG51956-UT
ANKRA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51956-ACGLN
ANKRA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51956-ACG
ANKRA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51956-ANG
ANKRA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51956-ACR
ANKRA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51956-ANR
ANKRA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51956-CF
ANKRA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51956-NF
ANKRA2 cDNA ORF Clone, Mouse, C-His tag MG51956-CH
ANKRA2 cDNA ORF Clone, Mouse, N-His tag MG51956-NH
ANKRA2 cDNA ORF Clone, Mouse, C-HA tag MG51956-CY
ANKRA2 cDNA ORF Clone, Mouse, N-HA tag MG51956-NY
ANKRA2 cDNA ORF Clone, Mouse, C-Myc tag MG51956-CM
ANKRA2 cDNA ORF Clone, Mouse, N-Myc tag MG51956-NM
ANKRA2 qPCR Primer Pairs, Mouse MP201829

ANKRA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANKRA2 cDNA ORF Clone in Cloning Vector, Human HG14711-G
ANKRA2 cDNA ORF Clone, Human, untagged HG14711-UT
ANKRA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14711-ACG
ANKRA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14711-ACGLN
ANKRA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14711-ANG
ANKRA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14711-ACR
ANKRA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14711-ANR
ANKRA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14711-CF
ANKRA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14711-NF
ANKRA2 cDNA ORF Clone, Human, C-His tag HG14711-CH
ANKRA2 cDNA ORF Clone, Human, N-His tag HG14711-NH
ANKRA2 cDNA ORF Clone, Human, N-HA tag HG14711-NY
ANKRA2 cDNA ORF Clone, Human, C-Myc tag HG14711-CM
ANKRA2 cDNA ORF Clone, Human, N-Myc tag HG14711-NM
ANKRA2 qPCR Primer Pairs, Human HP103345
info info
添加购物车成功! 添加购物车失败!