APC16 cDNA ORF Clone, Human, C-HA tag

Cat: HG16406-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All APC16 Reagents
CRO Services
Product recommended

All APC16 Reagents
APC16 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Human anaphase promoting complex subunit 16 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

APC16 cDNA ORF Clone, Human, C-HA tag Alternative Names
APC16 cDNA ORF Clone, Human;bA570G20.3 cDNA ORF Clone, Human;C10orf104 cDNA ORF Clone, Human;CENP-27 cDNA ORF Clone, Human;MSAG cDNA ORF Clone, Human
APC16 Background Information
Full Name
anaphase promoting complex subunit 16

APC16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
APC16 cDNA ORF Clone in Cloning Vector, Mouse MG52149-G
APC16 cDNA ORF Clone, Mouse, untagged MG52149-UT
APC16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52149-ACG
APC16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52149-ACGLN
APC16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52149-ANG
APC16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52149-ACR
APC16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52149-ANR
APC16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52149-CF
APC16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52149-NF
APC16 cDNA ORF Clone, Mouse, C-His tag MG52149-CH
APC16 cDNA ORF Clone, Mouse, N-His tag MG52149-NH
APC16 cDNA ORF Clone, Mouse, C-HA tag MG52149-CY
APC16 cDNA ORF Clone, Mouse, N-HA tag MG52149-NY
APC16 cDNA ORF Clone, Mouse, C-Myc tag MG52149-CM
APC16 cDNA ORF Clone, Mouse, N-Myc tag MG52149-NM
APC16 qPCR Primer Pairs, Mouse MP202022

APC16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
APC16 cDNA ORF Clone in Cloning Vector, Human HG16406-G
APC16 cDNA ORF Clone, Human, untagged HG16406-UT
APC16 cDNA ORF Clone, Human, C-GFPSpark® tag HG16406-ACG
APC16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16406-ACGLN
APC16 cDNA ORF Clone, Human, N-GFPSpark® tag HG16406-ANG
APC16 cDNA ORF Clone, Human, C-OFPSpark® tag HG16406-ACR
APC16 cDNA ORF Clone, Human, N-OFPSpark® tag HG16406-ANR
APC16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16406-CF
APC16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16406-NF
APC16 cDNA ORF Clone, Human, C-His tag HG16406-CH
APC16 cDNA ORF Clone, Human, N-His tag HG16406-NH
APC16 cDNA ORF Clone, Human, N-HA tag HG16406-NY
APC16 cDNA ORF Clone, Human, C-Myc tag HG16406-CM
APC16 cDNA ORF Clone, Human, N-Myc tag HG16406-NM
APC16 qPCR Primer Pairs, Human HP105155
info info
添加购物车成功! 添加购物车失败!