alpha amylase cDNA ORF Clone, Human, N-Myc tag

Cat: HG13277-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All alpha amylase Reagents
CRO Services
Product recommended

All alpha amylase Reagents
alpha amylase cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Human amylase, alpha 2A (pancreatic) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha amylase cDNA ORF Clone, Human, N-Myc tag Alternative Names
AMY2 cDNA ORF Clone, Human;AMY2A cDNA ORF Clone, Human;PA cDNA ORF Clone, Human
alpha amylase Background Information

Alpha-amylase is the major form of amylase found in humans and other mammals. Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. Alpha-amylase hydrolyses alpha bonds of large, alpha-linked polysaccharides, such as starch and glycogen, yielding glucose and maltose. Amylases is widely expressed and is most prominent in pancreatic juice and saliva, each of which has its own isoform of human α-amylase. They behave differently on isoelectric focusing, and can also be separated in testing by using specific monoclonal antibodies.

Full Name
amylase, alpha 2A (pancreatic)
References
  • Abe A, et al. (2005) Complexes of Thermoactinomyces vulgaris R-47 Alpha-amylase / AMY2A 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with alpha-(1,6) glycosidic linkages. FEBS J. 272(23):6145-53.
  • Aghajari, N, et al. (1998) Crystal structures of the psychrophilic Alpha-amylase / AMY2A from Alteromonas haloplanctis in its native form and complexed with an inhibitor. Protein Sci. 7(3): 564-72.
  • Ramasubbu, N, et al. (1996) Structure of Human Salivary -Amylase at 1.6 Resolution: Implications for its Role in the Oral Cavity. Acta Crystallographica Section D Biological Crystallography. 52(3):435-46.
  • info info
    添加购物车成功! 添加购物车失败!