Quick Order

Human JAML/AMICA1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human AMICA1 cDNA Clone Product Information
NCBI RefSeq:NM_001098526.1
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Homo sapiens adhesion molecule, interacts with CXADR antigen 1, transcript variant 1 with N terminal His tag.
Gene Synonym:JAML, AMICA, Gm638, CREA7-1, CREA7-4, FLJ37080, MGC118814, MGC118815, AMICA1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Junctional adhesion molecules (JAMs) are endothelial and epithelial adhesion molecules involved in the recruitment of circulating leukocytes to inflammatory sites. JAML (Junctional adhesion molecule-like), also known as AMICA1 (Adhesion molecule interacting with CXADR antigen 1), a protein related to the JAM family, is restricted to leukocytes and promotes their adhesion to endothelial cells. It contains 2 extracellular immunoglobulin-like domains, a transmembrane segment, and a cytoplasmic tail involved in activation signaling. Monocytic JAML/AMICA1 plays a critical role in regulating monocyte transendothelial migration (TEM) probably via binding to the endothelial coxsackie and adenovirus receptor (CAR) and other tight junction-associated adhesive molecules. The Expression of JAML/AMICA1 is restricted to the hematopoietic tissues with the exception of liver. JAML may function in transmigration of leukocytes through epithelial and endothelial tissues. Expressed at the plasma membrane of polymorphonuclear leukocytes, JAML/AMICA1 also enhances myeloid leukemia cell adhesion to endothelial cells.

References
  • Moog-Lutz C, et al. (2003) JAML, a novel protein with characteristics of a junctional adhesion molecule, is induced during differentiation of myeloid leukemia cells. Blood. 102(9): 3371-8.
  • Luissint AC, et al. (2008) JAM-L-mediated leukocyte adhesion to endothelial cells is regulated in cis by alpha4beta1 integrin activation. J Cell Biol. 183(6): 1159-73.
  • Guo YL, et al. (2009) Role of junctional adhesion molecule-like protein in mediating monocyte transendothelial migration. Arterioscler Thromb Vasc Biol. 29(1): 75-83.
  • Size / Price
    Catalog: HG10120-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"