AMDHD1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14783-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AMDHD1 Reagents
CRO Services
Product recommended

All AMDHD1 Reagents
AMDHD1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1281 bp
Description
Full length Clone DNA of Human amidohydrolase domain containing 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AMDHD1 cDNA ORF Clone, Human, N-HA tag Alternative Names
HMFT1272 cDNA ORF Clone, Human
AMDHD1 Background Information
Full Name
amidohydrolase domain containing 1

AMDHD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
AMDHD1 cDNA ORF Clone in Cloning Vector, Rat RG80563-U
AMDHD1 cDNA ORF Clone, Rat, untagged RG80563-UT
AMDHD1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80563-ACG
AMDHD1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80563-ACGLN
AMDHD1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80563-ANG
AMDHD1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80563-ACR
AMDHD1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80563-ANR
AMDHD1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80563-CF
AMDHD1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80563-NF
AMDHD1 cDNA ORF Clone, Rat, C-His tag RG80563-CH
AMDHD1 cDNA ORF Clone, Rat, N-His tag RG80563-NH
AMDHD1 cDNA ORF Clone, Rat, C-HA tag RG80563-CY
AMDHD1 cDNA ORF Clone, Rat, N-HA tag RG80563-NY
AMDHD1 cDNA ORF Clone, Rat, C-Myc tag RG80563-CM
AMDHD1 cDNA ORF Clone, Rat, N-Myc tag RG80563-NM
AMDHD1 qPCR Primer Pairs, Rat RP300527

AMDHD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AMDHD1 cDNA ORF Clone in Cloning Vector, Mouse MG55507-U
AMDHD1 cDNA ORF Clone, Mouse, untagged MG55507-UT
AMDHD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55507-ACGLN
AMDHD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55507-ACG
AMDHD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55507-ANG
AMDHD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55507-ACR
AMDHD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55507-ANR
AMDHD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55507-CF
AMDHD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55507-NF
AMDHD1 cDNA ORF Clone, Mouse, C-His tag MG55507-CH
AMDHD1 cDNA ORF Clone, Mouse, N-His tag MG55507-NH
AMDHD1 cDNA ORF Clone, Mouse, C-HA tag MG55507-CY
AMDHD1 cDNA ORF Clone, Mouse, N-HA tag MG55507-NY
AMDHD1 cDNA ORF Clone, Mouse, C-Myc tag MG55507-CM
AMDHD1 cDNA ORF Clone, Mouse, N-Myc tag MG55507-NM

AMDHD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AMDHD1 cDNA ORF Clone in Cloning Vector, Human HG14783-G
AMDHD1 cDNA ORF Clone, Human, untagged HG14783-UT
AMDHD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14783-ACG
AMDHD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14783-ACGLN
AMDHD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14783-ANG
AMDHD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14783-ACR
AMDHD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14783-ANR
AMDHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14783-CF
AMDHD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14783-NF
AMDHD1 cDNA ORF Clone, Human, C-His tag HG14783-CH
AMDHD1 cDNA ORF Clone, Human, N-His tag HG14783-NH
AMDHD1 cDNA ORF Clone, Human, C-HA tag HG14783-CY
AMDHD1 cDNA ORF Clone, Human, C-Myc tag HG14783-CM
AMDHD1 cDNA ORF Clone, Human, N-Myc tag HG14783-NM
AMDHD1 qPCR Primer Pairs, Human HP103416
info info
添加购物车成功! 添加购物车失败!