Bikunin cDNA ORF Clone, Human, N-Myc tag

Cat: HG13141-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Bikunin Reagents
CRO Services
Product recommended

All Bikunin Reagents
Bikunin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1059 bp
Description
Full length Clone DNA of Human alpha-1-microglobulin/bikunin precursor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Bikunin cDNA ORF Clone, Human, N-Myc tag Alternative Names
A1M cDNA ORF Clone, Human;EDC1 cDNA ORF Clone, Human;HCP cDNA ORF Clone, Human;HI30 cDNA ORF Clone, Human;IATIL cDNA ORF Clone, Human;ITI cDNA ORF Clone, Human;ITIL cDNA ORF Clone, Human;ITILC cDNA ORF Clone, Human;UTI cDNA ORF Clone, Human
Bikunin Background Information
Full Name
alpha-1-microglobulin/bikunin precursor

Bikunin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Bikunin cDNA ORF Clone in Cloning Vector, Rat RG81299-U
Bikunin cDNA ORF Clone, Rat, untagged RG81299-UT
Bikunin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81299-ACGLN
Bikunin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81299-ACG
Bikunin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81299-ACR
Bikunin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81299-CF
Bikunin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81299-NF
Bikunin cDNA ORF Clone, Rat, C-His tag RG81299-CH
Bikunin cDNA ORF Clone, Rat, N-His tag RG81299-NH
Bikunin cDNA ORF Clone, Rat, C-HA tag RG81299-CY
Bikunin cDNA ORF Clone, Rat, N-HA tag RG81299-NY
Bikunin cDNA ORF Clone, Rat, C-Myc tag RG81299-CM
Bikunin cDNA ORF Clone, Rat, N-Myc tag RG81299-NM
Bikunin qPCR Primer Pairs, Rat RP301255

Bikunin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Bikunin cDNA ORF Clone in Cloning Vector, Mouse MG53534-G
Bikunin cDNA ORF Clone, Mouse, untagged MG53534-UT
Bikunin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53534-ACG
Bikunin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53534-ACGLN
Bikunin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53534-ACR
Bikunin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53534-CF
Bikunin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53534-NF
Bikunin cDNA ORF Clone, Mouse, C-His tag MG53534-CH
Bikunin cDNA ORF Clone, Mouse, N-His tag MG53534-NH
Bikunin cDNA ORF Clone, Mouse, C-HA tag MG53534-CY
Bikunin cDNA ORF Clone, Mouse, N-HA tag MG53534-NY
Bikunin cDNA ORF Clone, Mouse, C-Myc tag MG53534-CM
Bikunin cDNA ORF Clone, Mouse, N-Myc tag MG53534-NM

Bikunin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Bikunin cDNA ORF Clone in Cloning Vector, Human HG13141-G
Bikunin cDNA ORF Clone, Human, untagged HG13141-UT
Bikunin cDNA ORF Clone, Human, C-GFPSpark® tag HG13141-ACG
Bikunin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13141-ACGLN
Bikunin cDNA ORF Clone, Human, C-OFPSpark® tag HG13141-ACR
Bikunin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13141-CF
Bikunin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13141-NF
Bikunin cDNA ORF Clone, Human, C-His tag HG13141-CH
Bikunin cDNA ORF Clone, Human, N-His tag HG13141-NH
Bikunin cDNA ORF Clone, Human, C-HA tag HG13141-CY
Bikunin cDNA ORF Clone, Human, N-HA tag HG13141-NY
Bikunin cDNA ORF Clone, Human, C-Myc tag HG13141-CM
Bikunin qPCR Primer Pairs, Human HP101760
info info
添加购物车成功! 添加购物车失败!