Quick Order

Text Size:AAA

Human Alkaline Phosphatase / ALPL Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ALPL cDNA Clone Product Information
NCBI RefSeq:NM_000478.4
RefSeq ORF Size:1575bp
cDNA Description:Full length Clone DNA of Homo sapiens alkaline phosphatase, liver/bone/kidney with C terminal Flag tag.
Gene Synonym:HOPS, TNAP, TNSALP, AP-TNAP, FLJ40094, FLJ93059, MGC161443, MGC167935, ALPL
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.

References
  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"