Quick Order

Human ALK-4 transcript variant 1 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human ACVR1B cDNA Clone Product Information
NCBI RefSeq:NM_004302.3
RefSeq ORF Size:1518bp
cDNA Description:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with N terminal HA tag.
Gene Synonym:ALK4, SKR2, ACTRIB, ACVRLK4
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

References
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • Size / Price
    Catalog: HG10583-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"