After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human ACVR1B cDNA Clone Product Information
NCBI RefSeq:NM_004302.3
RefSeq ORF Size:1518bp
cDNA Description:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with C terminal His tag.
Gene Synonym:ALK4, SKR2, ACTRIB, ACVRLK4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Background

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

References
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"