ALG2 cDNA ORF Clone, Human, C-HA tag

Cat: HG14650-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ALG2 Reagents
CRO Services
Product recommended

All ALG2 Reagents
ALG2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Human asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALG2 cDNA ORF Clone, Human, C-HA tag Alternative Names
CDGIi cDNA ORF Clone, Human;CMSTA3 cDNA ORF Clone, Human;hALPG2 cDNA ORF Clone, Human;NET38 cDNA ORF Clone, Human
ALG2 Background Information
Full Name
ALG2, alpha-1,3/1,6-mannosyltransferase

ALG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ALG2 cDNA ORF Clone in Cloning Vector, Rat RG81639-G
ALG2 cDNA ORF Clone, Rat, untagged RG81639-UT
ALG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81639-ACGLN
ALG2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81639-ACG
ALG2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81639-ANG
ALG2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81639-ACR
ALG2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81639-ANR
ALG2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81639-CF
ALG2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81639-NF
ALG2 cDNA ORF Clone, Rat, C-His tag RG81639-CH
ALG2 cDNA ORF Clone, Rat, N-His tag RG81639-NH
ALG2 cDNA ORF Clone, Rat, C-HA tag RG81639-CY
ALG2 cDNA ORF Clone, Rat, N-HA tag RG81639-NY
ALG2 cDNA ORF Clone, Rat, C-Myc tag RG81639-CM
ALG2 cDNA ORF Clone, Rat, N-Myc tag RG81639-NM

ALG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALG2 cDNA ORF Clone in Cloning Vector, Human HG14650-G
ALG2 cDNA ORF Clone, Human, untagged HG14650-UT
ALG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14650-ACGLN
ALG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14650-ACG
ALG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14650-ACR
ALG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14650-CF
ALG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14650-NF
ALG2 cDNA ORF Clone, Human, C-His tag HG14650-CH
ALG2 cDNA ORF Clone, Human, N-His tag HG14650-NH
ALG2 cDNA ORF Clone, Human, N-HA tag HG14650-NY
ALG2 cDNA ORF Clone, Human, C-Myc tag HG14650-CM
ALG2 cDNA ORF Clone, Human, N-Myc tag HG14650-NM
ALG2 qPCR Primer Pairs, Human HP103284
info info
添加购物车成功! 添加购物车失败!