ALG12 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14277-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALG12 Reagents
CRO Services
Product recommended

All ALG12 Reagents
ALG12 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1467 bp
Description
Full length Clone DNA of Human asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALG12 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CDG1G cDNA ORF Clone, Human;ECM39 cDNA ORF Clone, Human;hALG12 cDNA ORF Clone, Human;PP14673 cDNA ORF Clone, Human
ALG12 Background Information
Full Name
ALG12, alpha-1,6-mannosyltransferase

ALG12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALG12 cDNA ORF Clone in Cloning Vector, Mouse MG53667-U
ALG12 cDNA ORF Clone, Mouse, untagged MG53667-UT
ALG12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53667-ACGLN
ALG12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53667-ACG
ALG12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53667-ANG
ALG12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53667-ACR
ALG12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53667-ANR
ALG12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53667-CF
ALG12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53667-NF
ALG12 cDNA ORF Clone, Mouse, C-His tag MG53667-CH
ALG12 cDNA ORF Clone, Mouse, N-His tag MG53667-NH
ALG12 cDNA ORF Clone, Mouse, C-HA tag MG53667-CY
ALG12 cDNA ORF Clone, Mouse, N-HA tag MG53667-NY
ALG12 cDNA ORF Clone, Mouse, C-Myc tag MG53667-CM
ALG12 cDNA ORF Clone, Mouse, N-Myc tag MG53667-NM

ALG12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALG12 cDNA ORF Clone in Cloning Vector, Human HG14277-G
ALG12 cDNA ORF Clone, Human, untagged HG14277-UT
ALG12 cDNA ORF Clone, Human, C-GFPSpark® tag HG14277-ACG
ALG12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14277-ACGLN
ALG12 cDNA ORF Clone, Human, C-OFPSpark® tag HG14277-ACR
ALG12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14277-CF
ALG12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14277-NF
ALG12 cDNA ORF Clone, Human, C-His tag HG14277-CH
ALG12 cDNA ORF Clone, Human, N-His tag HG14277-NH
ALG12 cDNA ORF Clone, Human, C-HA tag HG14277-CY
ALG12 cDNA ORF Clone, Human, N-HA tag HG14277-NY
ALG12 cDNA ORF Clone, Human, N-Myc tag HG14277-NM
ALG12 qPCR Primer Pairs, Human HP102927
info info
添加购物车成功! 添加购物车失败!