aldolase A/ALDOA cDNA ORF Clone, Human, N-Myc tag

Cat: HG15534-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All aldolase A/ALDOA Reagents
CRO Services
Product recommended

All aldolase A/ALDOA Reagents
aldolase A/ALDOA cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Human aldolase A, fructose-bisphosphate with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

aldolase A/ALDOA cDNA ORF Clone, Human, N-Myc tag Alternative Names
ALDA cDNA ORF Clone, Human;GSD12 cDNA ORF Clone, Human;HEL-S-87p cDNA ORF Clone, Human
aldolase A/ALDOA Background Information
Full Name
aldolase A, fructose-bisphosphate

aldolase A/ALDOA cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
aldolase A/ALDOA cDNA ORF Clone in Cloning Vector, Rabbit TG65106-G
aldolase A/ALDOA cDNA ORF Clone, Rabbit, untagged TG65106-UT
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65106-ACG
aldolase A/ALDOA Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65106-ACGLN
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65106-ANG
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65106-ACR
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65106-ANR
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65106-CF
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65106-NF
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-His tag TG65106-CH
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-His tag TG65106-NH
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-HA tag TG65106-CY
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-HA tag TG65106-NY
aldolase A/ALDOA cDNA ORF Clone, Rabbit, C-Myc tag TG65106-CM
aldolase A/ALDOA cDNA ORF Clone, Rabbit, N-Myc tag TG65106-NM

aldolase A/ALDOA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
aldolase A/ALDOA cDNA ORF Clone in Cloning Vector, Rat RG80691-U
aldolase A/ALDOA cDNA ORF Clone, Rat, untagged RG80691-UT
aldolase A/ALDOA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80691-ACG
aldolase A/ALDOA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80691-ACGLN
aldolase A/ALDOA cDNA ORF Clone, Rat, N-GFPSpark® tag RG80691-ANG
aldolase A/ALDOA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80691-ACR
aldolase A/ALDOA cDNA ORF Clone, Rat, N-OFPSpark® tag RG80691-ANR
aldolase A/ALDOA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80691-CF
aldolase A/ALDOA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80691-NF
aldolase A/ALDOA cDNA ORF Clone, Rat, C-His tag RG80691-CH
aldolase A/ALDOA cDNA ORF Clone, Rat, N-His tag RG80691-NH
aldolase A/ALDOA cDNA ORF Clone, Rat, C-HA tag RG80691-CY
aldolase A/ALDOA cDNA ORF Clone, Rat, N-HA tag RG80691-NY
aldolase A/ALDOA cDNA ORF Clone, Rat, C-Myc tag RG80691-CM
aldolase A/ALDOA cDNA ORF Clone, Rat, N-Myc tag RG80691-NM
aldolase A/ALDOA qPCR Primer Pairs, Rat RP300655

aldolase A/ALDOA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
aldolase A/ALDOA cDNA ORF Clone in Cloning Vector, Mouse MG52539-U
aldolase A/ALDOA cDNA ORF Clone, Mouse, untagged MG52539-UT
aldolase A/ALDOA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52539-ACGLN
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52539-ACG
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52539-ANG
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52539-ACR
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52539-ANR
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52539-CF
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52539-NF
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-His tag MG52539-CH
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-His tag MG52539-NH
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-HA tag MG52539-CY
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-HA tag MG52539-NY
aldolase A/ALDOA cDNA ORF Clone, Mouse, C-Myc tag MG52539-CM
aldolase A/ALDOA cDNA ORF Clone, Mouse, N-Myc tag MG52539-NM
aldolase A/ALDOA qPCR Primer Pairs, Mouse MP202412

aldolase A/ALDOA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
aldolase A/ALDOA cDNA ORF Clone in Cloning Vector, Human HG15534-G
aldolase A/ALDOA cDNA ORF Clone, Human, untagged HG15534-UT
aldolase A/ALDOA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15534-ACGLN
aldolase A/ALDOA cDNA ORF Clone, Human, C-GFPSpark® tag HG15534-ACG
aldolase A/ALDOA cDNA ORF Clone, Human, N-GFPSpark® tag HG15534-ANG
aldolase A/ALDOA cDNA ORF Clone, Human, C-OFPSpark® tag HG15534-ACR
aldolase A/ALDOA cDNA ORF Clone, Human, N-OFPSpark® tag HG15534-ANR
aldolase A/ALDOA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15534-CF
aldolase A/ALDOA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15534-NF
aldolase A/ALDOA cDNA ORF Clone, Human, C-His tag HG15534-CH
aldolase A/ALDOA cDNA ORF Clone, Human, N-His tag HG15534-NH
aldolase A/ALDOA cDNA ORF Clone, Human, C-HA tag HG15534-CY
aldolase A/ALDOA cDNA ORF Clone, Human, N-HA tag HG15534-NY
aldolase A/ALDOA cDNA ORF Clone, Human, C-Myc tag HG15534-CM
aldolase A/ALDOA qPCR Primer Pairs, Human HP104155
info info
添加购物车成功! 添加购物车失败!