ALDH3A2 cDNA ORF Clone, Human, N-HA tag

Cat: HG11286-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH3A2 Reagents
CRO Services
Product recommended

All ALDH3A2 Reagents
ALDH3A2 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Description
Full length Clone DNA of Human ldehyde dehydrogenase 3 family, member A2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH3A2 cDNA ORF Clone, Human, N-HA tag Alternative Names
ALDH10 cDNA ORF Clone, Human;FALDH cDNA ORF Clone, Human;SLS cDNA ORF Clone, Human
ALDH3A2 Background Information
Full Name
aldehyde dehydrogenase 3 family, member A2

ALDH3A2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ALDH3A2 cDNA ORF Clone in Cloning Vector, Mouse MG59592-U
ALDH3A2 cDNA ORF Clone, Mouse, untagged MG59592-UT
ALDH3A2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59592-ACGLN
ALDH3A2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59592-ACG
ALDH3A2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59592-ANG
ALDH3A2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59592-ACR
ALDH3A2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59592-ANR
ALDH3A2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59592-CF
ALDH3A2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59592-NF
ALDH3A2 cDNA ORF Clone, Mouse, C-His tag MG59592-CH
ALDH3A2 cDNA ORF Clone, Mouse, N-His tag MG59592-NH
ALDH3A2 cDNA ORF Clone, Mouse, C-HA tag MG59592-CY
ALDH3A2 cDNA ORF Clone, Mouse, N-HA tag MG59592-NY
ALDH3A2 cDNA ORF Clone, Mouse, C-Myc tag MG59592-CM
ALDH3A2 cDNA ORF Clone, Mouse, N-Myc tag MG59592-NM

ALDH3A2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ALDH3A2 cDNA ORF Clone in Cloning Vector, Human HG11286-M
ALDH3A2 cDNA ORF Clone, Human, untagged HG11286-UT
ALDH3A2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11286-ACG
ALDH3A2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11286-ACGLN
ALDH3A2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11286-ACR
ALDH3A2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11286-CF
ALDH3A2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11286-NF
ALDH3A2 cDNA ORF Clone, Human, C-His tag HG11286-CH
ALDH3A2 cDNA ORF Clone, Human, N-His tag HG11286-NH
ALDH3A2 cDNA ORF Clone, Human, C-HA tag HG11286-CY
ALDH3A2 cDNA ORF Clone, Human, C-Myc tag HG11286-CM
ALDH3A2 cDNA ORF Clone, Human, N-Myc tag HG11286-NM
ALDH3A2 qPCR Primer Pairs, Human HP101164
info info
添加购物车成功! 添加购物车失败!