ALDH3A1 cDNA ORF Clone, Human, N-His tag

Cat: HG13129-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ALDH3A1 Reagents
CRO Services
Product recommended

All ALDH3A1 Reagents
ALDH3A1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Human aldehyde dehydrogenase 3 family, member A1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ALDH3A1 cDNA ORF Clone, Human, N-His tag Alternative Names
ALDH3 cDNA ORF Clone, Human;ALDHIII cDNA ORF Clone, Human
ALDH3A1 Background Information
Full Name
aldehyde dehydrogenase 3 family, member A1
References
  • Pappa A, et al. (2003) Human aldehyde dehydrogenase 3A1 (ALDH3A1): biochemical characterization and immunohistochemical localization in the cornea. Biochem J. 376(3): 615-23.
  • Estey T, et al. (2007) ALDH3A1: a corneal crystallin with diverse functions. Experimental Eye Research. 84(1):3-12.
  • Pappa A, et al. (2003) Aldh3a1 protects human corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage. Free Radical Biology and Medicine. 34(9):1178-89.
  • ALDH3A1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ALDH3A1 cDNA ORF Clone, Mouse, untagged MG58701-UT
    ALDH3A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58701-ACGLN
    ALDH3A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58701-ACG
    ALDH3A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58701-ANG
    ALDH3A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58701-ACR
    ALDH3A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58701-ANR
    ALDH3A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58701-CF
    ALDH3A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58701-NF
    ALDH3A1 cDNA ORF Clone, Mouse, C-His tag MG58701-CH
    ALDH3A1 cDNA ORF Clone, Mouse, N-His tag MG58701-NH
    ALDH3A1 cDNA ORF Clone, Mouse, C-HA tag MG58701-CY
    ALDH3A1 cDNA ORF Clone, Mouse, N-HA tag MG58701-NY
    ALDH3A1 cDNA ORF Clone, Mouse, C-Myc tag MG58701-CM
    ALDH3A1 cDNA ORF Clone, Mouse, N-Myc tag MG58701-NM

    ALDH3A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ALDH3A1 cDNA ORF Clone in Cloning Vector, Human HG13129-G
    ALDH3A1 cDNA ORF Clone in Cloning Vector, Human HG17215-U
    ALDH3A1 cDNA ORF Clone, Human, untagged HG17215-UT
    ALDH3A1 cDNA ORF Clone, Human, untagged HG13129-UT
    ALDH3A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17215-ACGLN
    ALDH3A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17215-ACG
    ALDH3A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13129-ACG
    ALDH3A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12523-ACGLN
    ALDH3A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13129-ACGLN
    ALDH3A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13129-ANG
    ALDH3A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17215-ANG
    ALDH3A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17215-ACR
    ALDH3A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13129-ACR
    ALDH3A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17215-ANR
    ALDH3A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13129-ANR
    ALDH3A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17215-CF
    ALDH3A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13129-CF
    ALDH3A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17215-NF
    ALDH3A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13129-NF
    ALDH3A1 cDNA ORF Clone, Human, C-His tag HG17215-CH
    ALDH3A1 cDNA ORF Clone, Human, C-His tag HG13129-CH
    ALDH3A1 cDNA ORF Clone, Human, N-His tag HG17215-NH
    ALDH3A1 cDNA ORF Clone, Human, C-HA tag HG13129-CY
    ALDH3A1 cDNA ORF Clone, Human, C-HA tag HG17215-CY
    ALDH3A1 cDNA ORF Clone, Human, N-HA tag HG13129-NY
    ALDH3A1 cDNA ORF Clone, Human, N-HA tag HG17215-NY
    ALDH3A1 cDNA ORF Clone, Human, C-Myc tag HG13129-CM
    ALDH3A1 cDNA ORF Clone, Human, C-Myc tag HG17215-CM
    ALDH3A1 cDNA ORF Clone, Human, N-Myc tag HG13129-NM
    ALDH3A1 cDNA ORF Clone, Human, N-Myc tag HG17215-NM
    ALDH3A1 qPCR Primer Pairs, Human HP101749
    info info
    添加购物车成功! 添加购物车失败!